ID: 1175664778

View in Genome Browser
Species Human (GRCh38)
Location 20:60849291-60849313
Sequence GAGCTCTTTCTCTGACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175664777_1175664778 -5 Left 1175664777 20:60849273-60849295 CCTCTCTAGAGAACTTTGGAGCT No data
Right 1175664778 20:60849291-60849313 GAGCTCTTTCTCTGACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175664778 Original CRISPR GAGCTCTTTCTCTGACACCC TGG Intergenic
No off target data available for this crispr