ID: 1175670856

View in Genome Browser
Species Human (GRCh38)
Location 20:60901663-60901685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175670854_1175670856 12 Left 1175670854 20:60901628-60901650 CCTTTTTCAGATCAGGTACATGG No data
Right 1175670856 20:60901663-60901685 TCCCATGCACAGTCTATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175670856 Original CRISPR TCCCATGCACAGTCTATGCA AGG Intergenic
No off target data available for this crispr