ID: 1175670859

View in Genome Browser
Species Human (GRCh38)
Location 20:60901665-60901687
Sequence CCCCTTGCATAGACTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175670859_1175670863 -3 Left 1175670859 20:60901665-60901687 CCATGCACAGTCTATGCAAGGGG No data
Right 1175670863 20:60901685-60901707 GGGAGGAACATTTGTTTTGTGGG No data
1175670859_1175670862 -4 Left 1175670859 20:60901665-60901687 CCATGCACAGTCTATGCAAGGGG No data
Right 1175670862 20:60901684-60901706 GGGGAGGAACATTTGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175670859 Original CRISPR CCCCTTGCATAGACTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr