ID: 1175671968

View in Genome Browser
Species Human (GRCh38)
Location 20:60911084-60911106
Sequence CTGAGCTATTACTTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175671968_1175671971 23 Left 1175671968 20:60911084-60911106 CCTTGCACCAAGTAATAGCTCAG No data
Right 1175671971 20:60911130-60911152 TAAACTCAGGCCGTGCGCAGTGG No data
1175671968_1175671970 10 Left 1175671968 20:60911084-60911106 CCTTGCACCAAGTAATAGCTCAG No data
Right 1175671970 20:60911117-60911139 TTAAATAAAATAATAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175671968 Original CRISPR CTGAGCTATTACTTGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr