ID: 1175673453

View in Genome Browser
Species Human (GRCh38)
Location 20:60926695-60926717
Sequence CTCTAGCAAAGGCAGTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175673448_1175673453 -3 Left 1175673448 20:60926675-60926697 CCACCTGATCTATTTACCTGCTC No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673440_1175673453 26 Left 1175673440 20:60926646-60926668 CCAGGAGAGGCTGGATTCCTGCC No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673447_1175673453 3 Left 1175673447 20:60926669-60926691 CCGGGGCCACCTGATCTATTTAC No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673446_1175673453 4 Left 1175673446 20:60926668-60926690 CCCGGGGCCACCTGATCTATTTA No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673445_1175673453 5 Left 1175673445 20:60926667-60926689 CCCCGGGGCCACCTGATCTATTT No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673444_1175673453 9 Left 1175673444 20:60926663-60926685 CCTGCCCCGGGGCCACCTGATCT No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673439_1175673453 27 Left 1175673439 20:60926645-60926667 CCCAGGAGAGGCTGGATTCCTGC No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data
1175673449_1175673453 -6 Left 1175673449 20:60926678-60926700 CCTGATCTATTTACCTGCTCTAG No data
Right 1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175673453 Original CRISPR CTCTAGCAAAGGCAGTTGTA GGG Intergenic
No off target data available for this crispr