ID: 1175673539

View in Genome Browser
Species Human (GRCh38)
Location 20:60927627-60927649
Sequence CCTGTTCAGCTGACAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175673535_1175673539 2 Left 1175673535 20:60927602-60927624 CCCTGTGAATACTGATTGCTGTT 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1175673539 20:60927627-60927649 CCTGTTCAGCTGACAGATTAAGG No data
1175673536_1175673539 1 Left 1175673536 20:60927603-60927625 CCTGTGAATACTGATTGCTGTTG 0: 1
1: 0
2: 3
3: 17
4: 119
Right 1175673539 20:60927627-60927649 CCTGTTCAGCTGACAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175673539 Original CRISPR CCTGTTCAGCTGACAGATTA AGG Intergenic
No off target data available for this crispr