ID: 1175674116

View in Genome Browser
Species Human (GRCh38)
Location 20:60932287-60932309
Sequence CAATGTATGAACCTCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175674116_1175674119 -7 Left 1175674116 20:60932287-60932309 CCAGCTCTGAGGTTCATACATTG No data
Right 1175674119 20:60932303-60932325 TACATTGGCCAGTAGGAATATGG No data
1175674116_1175674120 0 Left 1175674116 20:60932287-60932309 CCAGCTCTGAGGTTCATACATTG No data
Right 1175674120 20:60932310-60932332 GCCAGTAGGAATATGGAGCCAGG No data
1175674116_1175674124 19 Left 1175674116 20:60932287-60932309 CCAGCTCTGAGGTTCATACATTG No data
Right 1175674124 20:60932329-60932351 CAGGAGGAAATCTCGCTGACTGG No data
1175674116_1175674122 3 Left 1175674116 20:60932287-60932309 CCAGCTCTGAGGTTCATACATTG No data
Right 1175674122 20:60932313-60932335 AGTAGGAATATGGAGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175674116 Original CRISPR CAATGTATGAACCTCAGAGC TGG (reversed) Intergenic