ID: 1175674686

View in Genome Browser
Species Human (GRCh38)
Location 20:60936589-60936611
Sequence AGCCCACACAAGAGAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175674686_1175674691 3 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674691 20:60936615-60936637 GGCTTCAGCCTGGAGTTGTGGGG No data
1175674686_1175674690 2 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674690 20:60936614-60936636 TGGCTTCAGCCTGGAGTTGTGGG No data
1175674686_1175674689 1 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674689 20:60936613-60936635 CTGGCTTCAGCCTGGAGTTGTGG No data
1175674686_1175674688 -7 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674688 20:60936605-60936627 GTGGGCTGCTGGCTTCAGCCTGG No data
1175674686_1175674694 12 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674694 20:60936624-60936646 CTGGAGTTGTGGGGTTTGATGGG No data
1175674686_1175674693 11 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674693 20:60936623-60936645 CCTGGAGTTGTGGGGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175674686 Original CRISPR AGCCCACACAAGAGAGTGAG AGG (reversed) Intergenic