ID: 1175674693

View in Genome Browser
Species Human (GRCh38)
Location 20:60936623-60936645
Sequence CCTGGAGTTGTGGGGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175674686_1175674693 11 Left 1175674686 20:60936589-60936611 CCTCTCACTCTCTTGTGTGGGCT No data
Right 1175674693 20:60936623-60936645 CCTGGAGTTGTGGGGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175674693 Original CRISPR CCTGGAGTTGTGGGGTTTGA TGG Intergenic