ID: 1175674785

View in Genome Browser
Species Human (GRCh38)
Location 20:60937164-60937186
Sequence CATTCTGTCCGCCCTGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175674785_1175674789 -3 Left 1175674785 20:60937164-60937186 CCCCCATCAGGGCGGACAGAATG No data
Right 1175674789 20:60937184-60937206 ATGAAAAGTCTTCTGACACTTGG No data
1175674785_1175674792 22 Left 1175674785 20:60937164-60937186 CCCCCATCAGGGCGGACAGAATG No data
Right 1175674792 20:60937209-60937231 TGTGGTATAGCCAGAGCTCAGGG No data
1175674785_1175674793 23 Left 1175674785 20:60937164-60937186 CCCCCATCAGGGCGGACAGAATG No data
Right 1175674793 20:60937210-60937232 GTGGTATAGCCAGAGCTCAGGGG No data
1175674785_1175674791 21 Left 1175674785 20:60937164-60937186 CCCCCATCAGGGCGGACAGAATG No data
Right 1175674791 20:60937208-60937230 TTGTGGTATAGCCAGAGCTCAGG No data
1175674785_1175674790 4 Left 1175674785 20:60937164-60937186 CCCCCATCAGGGCGGACAGAATG No data
Right 1175674790 20:60937191-60937213 GTCTTCTGACACTTGGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175674785 Original CRISPR CATTCTGTCCGCCCTGATGG GGG (reversed) Intergenic
No off target data available for this crispr