ID: 1175675525

View in Genome Browser
Species Human (GRCh38)
Location 20:60943409-60943431
Sequence CAGGGTAGGGCAGCGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175675515_1175675525 28 Left 1175675515 20:60943358-60943380 CCAAGAGCACACAGGAGCTTTGG No data
Right 1175675525 20:60943409-60943431 CAGGGTAGGGCAGCGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175675525 Original CRISPR CAGGGTAGGGCAGCGGTGGT AGG Intergenic
No off target data available for this crispr