ID: 1175679962

View in Genome Browser
Species Human (GRCh38)
Location 20:60978891-60978913
Sequence GTGCGGAGGAGTAGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175679958_1175679962 2 Left 1175679958 20:60978866-60978888 CCTATGCTATGCTTCTCTTGAAT No data
Right 1175679962 20:60978891-60978913 GTGCGGAGGAGTAGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175679962 Original CRISPR GTGCGGAGGAGTAGAACTGC TGG Intergenic
No off target data available for this crispr