ID: 1175682401

View in Genome Browser
Species Human (GRCh38)
Location 20:60999371-60999393
Sequence TTGCTTTGCTCACCAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175682401_1175682406 25 Left 1175682401 20:60999371-60999393 CCAGGGTTTGGTGAGCAAAGCAA No data
Right 1175682406 20:60999419-60999441 TTTTTTTTTTCGTATAAAAAGGG No data
1175682401_1175682407 28 Left 1175682401 20:60999371-60999393 CCAGGGTTTGGTGAGCAAAGCAA No data
Right 1175682407 20:60999422-60999444 TTTTTTTCGTATAAAAAGGGTGG No data
1175682401_1175682405 24 Left 1175682401 20:60999371-60999393 CCAGGGTTTGGTGAGCAAAGCAA No data
Right 1175682405 20:60999418-60999440 TTTTTTTTTTTCGTATAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175682401 Original CRISPR TTGCTTTGCTCACCAAACCC TGG (reversed) Intergenic
No off target data available for this crispr