ID: 1175684021

View in Genome Browser
Species Human (GRCh38)
Location 20:61013914-61013936
Sequence GAGTTCTCAAAAGAGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175684021_1175684024 -2 Left 1175684021 20:61013914-61013936 CCAACTAGCTCTTTTGAGAACTC No data
Right 1175684024 20:61013935-61013957 TCTATCACCAGAACAGTAAGGGG No data
1175684021_1175684022 -4 Left 1175684021 20:61013914-61013936 CCAACTAGCTCTTTTGAGAACTC No data
Right 1175684022 20:61013933-61013955 ACTCTATCACCAGAACAGTAAGG No data
1175684021_1175684025 -1 Left 1175684021 20:61013914-61013936 CCAACTAGCTCTTTTGAGAACTC No data
Right 1175684025 20:61013936-61013958 CTATCACCAGAACAGTAAGGGGG No data
1175684021_1175684023 -3 Left 1175684021 20:61013914-61013936 CCAACTAGCTCTTTTGAGAACTC No data
Right 1175684023 20:61013934-61013956 CTCTATCACCAGAACAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175684021 Original CRISPR GAGTTCTCAAAAGAGCTAGT TGG (reversed) Intergenic
No off target data available for this crispr