ID: 1175685302

View in Genome Browser
Species Human (GRCh38)
Location 20:61024095-61024117
Sequence CCACCCACGTGGCCACTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175685295_1175685302 -5 Left 1175685295 20:61024077-61024099 CCACTCGCAGGGAGCCCCCCACC No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685293_1175685302 4 Left 1175685293 20:61024068-61024090 CCCACGCGGCCACTCGCAGGGAG No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685290_1175685302 7 Left 1175685290 20:61024065-61024087 CCGCCCACGCGGCCACTCGCAGG No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685294_1175685302 3 Left 1175685294 20:61024069-61024091 CCACGCGGCCACTCGCAGGGAGC No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685287_1175685302 10 Left 1175685287 20:61024062-61024084 CCCCCGCCCACGCGGCCACTCGC No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685288_1175685302 9 Left 1175685288 20:61024063-61024085 CCCCGCCCACGCGGCCACTCGCA No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685289_1175685302 8 Left 1175685289 20:61024064-61024086 CCCGCCCACGCGGCCACTCGCAG No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data
1175685285_1175685302 23 Left 1175685285 20:61024049-61024071 CCACTGGCAGGAGCCCCCGCCCA No data
Right 1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175685302 Original CRISPR CCACCCACGTGGCCACTCGC AGG Intergenic
No off target data available for this crispr