ID: 1175689744

View in Genome Browser
Species Human (GRCh38)
Location 20:61056834-61056856
Sequence GGCTGCAGAGAGTCTAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175689744_1175689752 19 Left 1175689744 20:61056834-61056856 CCTATCTTAGACTCTCTGCAGCC No data
Right 1175689752 20:61056876-61056898 ACCATTCCCACCCATGGGGCAGG No data
1175689744_1175689751 15 Left 1175689744 20:61056834-61056856 CCTATCTTAGACTCTCTGCAGCC No data
Right 1175689751 20:61056872-61056894 AGCAACCATTCCCACCCATGGGG No data
1175689744_1175689749 13 Left 1175689744 20:61056834-61056856 CCTATCTTAGACTCTCTGCAGCC No data
Right 1175689749 20:61056870-61056892 TCAGCAACCATTCCCACCCATGG No data
1175689744_1175689746 -10 Left 1175689744 20:61056834-61056856 CCTATCTTAGACTCTCTGCAGCC No data
Right 1175689746 20:61056847-61056869 CTCTGCAGCCCTTCGAGGTGAGG No data
1175689744_1175689750 14 Left 1175689744 20:61056834-61056856 CCTATCTTAGACTCTCTGCAGCC No data
Right 1175689750 20:61056871-61056893 CAGCAACCATTCCCACCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175689744 Original CRISPR GGCTGCAGAGAGTCTAAGAT AGG (reversed) Intergenic
No off target data available for this crispr