ID: 1175691296

View in Genome Browser
Species Human (GRCh38)
Location 20:61067711-61067733
Sequence CAGTAGAACTGGGGGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175691296_1175691303 10 Left 1175691296 20:61067711-61067733 CCCAGTTGCCCCCAGTTCTACTG No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175691296 Original CRISPR CAGTAGAACTGGGGGCAACT GGG (reversed) Intergenic
No off target data available for this crispr