ID: 1175691298

View in Genome Browser
Species Human (GRCh38)
Location 20:61067719-61067741
Sequence GTGAGCAGCAGTAGAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175691298_1175691305 25 Left 1175691298 20:61067719-61067741 CCCCCAGTTCTACTGCTGCTCAC No data
Right 1175691305 20:61067767-61067789 AGATGACACGTAGATCCCAATGG No data
1175691298_1175691303 2 Left 1175691298 20:61067719-61067741 CCCCCAGTTCTACTGCTGCTCAC No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175691298 Original CRISPR GTGAGCAGCAGTAGAACTGG GGG (reversed) Intergenic
No off target data available for this crispr