ID: 1175691303

View in Genome Browser
Species Human (GRCh38)
Location 20:61067744-61067766
Sequence CTGCACTGTTCCTAGACGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175691299_1175691303 1 Left 1175691299 20:61067720-61067742 CCCCAGTTCTACTGCTGCTCACA No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data
1175691296_1175691303 10 Left 1175691296 20:61067711-61067733 CCCAGTTGCCCCCAGTTCTACTG No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data
1175691297_1175691303 9 Left 1175691297 20:61067712-61067734 CCAGTTGCCCCCAGTTCTACTGC No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data
1175691295_1175691303 13 Left 1175691295 20:61067708-61067730 CCGCCCAGTTGCCCCCAGTTCTA No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data
1175691298_1175691303 2 Left 1175691298 20:61067719-61067741 CCCCCAGTTCTACTGCTGCTCAC No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data
1175691300_1175691303 0 Left 1175691300 20:61067721-61067743 CCCAGTTCTACTGCTGCTCACAC No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data
1175691301_1175691303 -1 Left 1175691301 20:61067722-61067744 CCAGTTCTACTGCTGCTCACACC No data
Right 1175691303 20:61067744-61067766 CTGCACTGTTCCTAGACGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175691303 Original CRISPR CTGCACTGTTCCTAGACGTC TGG Intergenic
No off target data available for this crispr