ID: 1175693703

View in Genome Browser
Species Human (GRCh38)
Location 20:61085168-61085190
Sequence AGCCATGGGAAGCCAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175693703_1175693708 7 Left 1175693703 20:61085168-61085190 CCATCTCCTGGCTTCCCATGGCT No data
Right 1175693708 20:61085198-61085220 CCAGCACCAGCACCTGTGTCAGG No data
1175693703_1175693712 28 Left 1175693703 20:61085168-61085190 CCATCTCCTGGCTTCCCATGGCT No data
Right 1175693712 20:61085219-61085241 GGCCACCAGCTGAGCAGGTGTGG No data
1175693703_1175693711 23 Left 1175693703 20:61085168-61085190 CCATCTCCTGGCTTCCCATGGCT No data
Right 1175693711 20:61085214-61085236 TGTCAGGCCACCAGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175693703 Original CRISPR AGCCATGGGAAGCCAGGAGA TGG (reversed) Intergenic
No off target data available for this crispr