ID: 1175694005

View in Genome Browser
Species Human (GRCh38)
Location 20:61087623-61087645
Sequence GGCCCTATTAATTTTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175694005_1175694009 -2 Left 1175694005 20:61087623-61087645 CCTTCTCTAAAATTAATAGGGCC No data
Right 1175694009 20:61087644-61087666 CCCGATCTCCAGGGAAGACCAGG No data
1175694005_1175694012 8 Left 1175694005 20:61087623-61087645 CCTTCTCTAAAATTAATAGGGCC No data
Right 1175694012 20:61087654-61087676 AGGGAAGACCAGGCAGAGCCTGG No data
1175694005_1175694014 17 Left 1175694005 20:61087623-61087645 CCTTCTCTAAAATTAATAGGGCC No data
Right 1175694014 20:61087663-61087685 CAGGCAGAGCCTGGACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175694005 Original CRISPR GGCCCTATTAATTTTAGAGA AGG (reversed) Intergenic
No off target data available for this crispr