ID: 1175695409

View in Genome Browser
Species Human (GRCh38)
Location 20:61099530-61099552
Sequence CAGGTATAAGAGCCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175695399_1175695409 14 Left 1175695399 20:61099493-61099515 CCCAGGTTAGTCTTCTCAGCCAC No data
Right 1175695409 20:61099530-61099552 CAGGTATAAGAGCCCTTGGTGGG No data
1175695400_1175695409 13 Left 1175695400 20:61099494-61099516 CCAGGTTAGTCTTCTCAGCCACT No data
Right 1175695409 20:61099530-61099552 CAGGTATAAGAGCCCTTGGTGGG No data
1175695403_1175695409 -5 Left 1175695403 20:61099512-61099534 CCACTGCCTCCTGGTCCTCAGGT No data
Right 1175695409 20:61099530-61099552 CAGGTATAAGAGCCCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175695409 Original CRISPR CAGGTATAAGAGCCCTTGGT GGG Intergenic
No off target data available for this crispr