ID: 1175697935

View in Genome Browser
Species Human (GRCh38)
Location 20:61116593-61116615
Sequence CCTGGGTGCCAAGTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175697935_1175697943 9 Left 1175697935 20:61116593-61116615 CCAGCAGAAACTTGGCACCCAGG No data
Right 1175697943 20:61116625-61116647 AGGGCATGTTTCTGCTTACACGG No data
1175697935_1175697938 -10 Left 1175697935 20:61116593-61116615 CCAGCAGAAACTTGGCACCCAGG No data
Right 1175697938 20:61116606-61116628 GGCACCCAGGCAGCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175697935 Original CRISPR CCTGGGTGCCAAGTTTCTGC TGG (reversed) Intergenic
No off target data available for this crispr