ID: 1175698759

View in Genome Browser
Species Human (GRCh38)
Location 20:61122396-61122418
Sequence TGGGACCACCTAAATGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175698757_1175698759 -9 Left 1175698757 20:61122382-61122404 CCCTATGAGGACACTGGGACCAC No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698747_1175698759 27 Left 1175698747 20:61122346-61122368 CCCTGACTCTGACCTTCCTGCCC No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698748_1175698759 26 Left 1175698748 20:61122347-61122369 CCTGACTCTGACCTTCCTGCCCC No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698751_1175698759 7 Left 1175698751 20:61122366-61122388 CCCCATCTCATAAGAACCCTATG No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698758_1175698759 -10 Left 1175698758 20:61122383-61122405 CCTATGAGGACACTGGGACCACC No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698750_1175698759 11 Left 1175698750 20:61122362-61122384 CCTGCCCCATCTCATAAGAACCC No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698749_1175698759 15 Left 1175698749 20:61122358-61122380 CCTTCCTGCCCCATCTCATAAGA No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698753_1175698759 5 Left 1175698753 20:61122368-61122390 CCATCTCATAAGAACCCTATGAG No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data
1175698752_1175698759 6 Left 1175698752 20:61122367-61122389 CCCATCTCATAAGAACCCTATGA No data
Right 1175698759 20:61122396-61122418 TGGGACCACCTAAATGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175698759 Original CRISPR TGGGACCACCTAAATGATCC AGG Intergenic
No off target data available for this crispr