ID: 1175700074

View in Genome Browser
Species Human (GRCh38)
Location 20:61130572-61130594
Sequence GGGGCTGAAGAATCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175700074_1175700083 12 Left 1175700074 20:61130572-61130594 CCCACAGTGGATTCTTCAGCCCC No data
Right 1175700083 20:61130607-61130629 AACTGTTCCTGCATTTTGCAGGG No data
1175700074_1175700082 11 Left 1175700074 20:61130572-61130594 CCCACAGTGGATTCTTCAGCCCC No data
Right 1175700082 20:61130606-61130628 GAACTGTTCCTGCATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175700074 Original CRISPR GGGGCTGAAGAATCCACTGT GGG (reversed) Intergenic