ID: 1175700598

View in Genome Browser
Species Human (GRCh38)
Location 20:61134141-61134163
Sequence GTGCTGGTCCGGGAGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175700598_1175700608 30 Left 1175700598 20:61134141-61134163 CCACAGCCCTCCCGGACCAGCAC No data
Right 1175700608 20:61134194-61134216 ACTTGTTTACATTACACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175700598 Original CRISPR GTGCTGGTCCGGGAGGGCTG TGG (reversed) Intergenic
No off target data available for this crispr