ID: 1175702181

View in Genome Browser
Species Human (GRCh38)
Location 20:61147582-61147604
Sequence TACTCTGGAATGTTCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175702181_1175702187 22 Left 1175702181 20:61147582-61147604 CCCACCAGGAACATTCCAGAGTA No data
Right 1175702187 20:61147627-61147649 CCCAGTCCCCGCCACATGCCAGG No data
1175702181_1175702192 29 Left 1175702181 20:61147582-61147604 CCCACCAGGAACATTCCAGAGTA No data
Right 1175702192 20:61147634-61147656 CCCGCCACATGCCAGGCACTGGG No data
1175702181_1175702190 28 Left 1175702181 20:61147582-61147604 CCCACCAGGAACATTCCAGAGTA No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175702181 Original CRISPR TACTCTGGAATGTTCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr