ID: 1175702184

View in Genome Browser
Species Human (GRCh38)
Location 20:61147597-61147619
Sequence CTGTGGAATGAACTCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175702184_1175702190 13 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702184_1175702187 7 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702187 20:61147627-61147649 CCCAGTCCCCGCCACATGCCAGG No data
1175702184_1175702198 25 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702198 20:61147645-61147667 CCAGGCACTGGGCTTGGCTAGGG No data
1175702184_1175702196 24 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702196 20:61147644-61147666 GCCAGGCACTGGGCTTGGCTAGG No data
1175702184_1175702192 14 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702192 20:61147634-61147656 CCCGCCACATGCCAGGCACTGGG No data
1175702184_1175702195 19 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702195 20:61147639-61147661 CACATGCCAGGCACTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175702184 Original CRISPR CTGTGGAATGAACTCTACTC TGG (reversed) Intergenic
No off target data available for this crispr