ID: 1175702185

View in Genome Browser
Species Human (GRCh38)
Location 20:61147614-61147636
Sequence GGGGACTGGGTATATATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175702185_1175702198 8 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702198 20:61147645-61147667 CCAGGCACTGGGCTTGGCTAGGG No data
1175702185_1175702190 -4 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702185_1175702195 2 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702195 20:61147639-61147661 CACATGCCAGGCACTGGGCTTGG No data
1175702185_1175702196 7 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702196 20:61147644-61147666 GCCAGGCACTGGGCTTGGCTAGG No data
1175702185_1175702200 17 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702200 20:61147654-61147676 GGGCTTGGCTAGGGTCAAGGTGG No data
1175702185_1175702199 14 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702199 20:61147651-61147673 ACTGGGCTTGGCTAGGGTCAAGG No data
1175702185_1175702192 -3 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702192 20:61147634-61147656 CCCGCCACATGCCAGGCACTGGG No data
1175702185_1175702187 -10 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702187 20:61147627-61147649 CCCAGTCCCCGCCACATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175702185 Original CRISPR GGGGACTGGGTATATATCTG TGG (reversed) Intergenic
No off target data available for this crispr