ID: 1175702190

View in Genome Browser
Species Human (GRCh38)
Location 20:61147633-61147655
Sequence CCCCGCCACATGCCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175702180_1175702190 29 Left 1175702180 20:61147581-61147603 CCCCACCAGGAACATTCCAGAGT No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702184_1175702190 13 Left 1175702184 20:61147597-61147619 CCAGAGTAGAGTTCATTCCACAG No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702183_1175702190 24 Left 1175702183 20:61147586-61147608 CCAGGAACATTCCAGAGTAGAGT No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702181_1175702190 28 Left 1175702181 20:61147582-61147604 CCCACCAGGAACATTCCAGAGTA No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702185_1175702190 -4 Left 1175702185 20:61147614-61147636 CCACAGATATATACCCAGTCCCC No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data
1175702182_1175702190 27 Left 1175702182 20:61147583-61147605 CCACCAGGAACATTCCAGAGTAG No data
Right 1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175702190 Original CRISPR CCCCGCCACATGCCAGGCAC TGG Intergenic
No off target data available for this crispr