ID: 1175704875

View in Genome Browser
Species Human (GRCh38)
Location 20:61169178-61169200
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175704866_1175704875 0 Left 1175704866 20:61169155-61169177 CCTTCAAAGGATTGGACAAGGCC No data
Right 1175704875 20:61169178-61169200 CCCCATACTGAGGTGGGGTAGGG No data
1175704862_1175704875 19 Left 1175704862 20:61169136-61169158 CCTTTGTGTTCTATGCAGTCCTT No data
Right 1175704875 20:61169178-61169200 CCCCATACTGAGGTGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175704875 Original CRISPR CCCCATACTGAGGTGGGGTA GGG Intergenic
No off target data available for this crispr