ID: 1175704875 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:61169178-61169200 |
| Sequence | CCCCATACTGAGGTGGGGTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175704866_1175704875 | 0 | Left | 1175704866 | 20:61169155-61169177 | CCTTCAAAGGATTGGACAAGGCC | No data | ||
| Right | 1175704875 | 20:61169178-61169200 | CCCCATACTGAGGTGGGGTAGGG | No data | ||||
| 1175704862_1175704875 | 19 | Left | 1175704862 | 20:61169136-61169158 | CCTTTGTGTTCTATGCAGTCCTT | No data | ||
| Right | 1175704875 | 20:61169178-61169200 | CCCCATACTGAGGTGGGGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175704875 | Original CRISPR | CCCCATACTGAGGTGGGGTA GGG | Intergenic | ||
| No off target data available for this crispr | |||||