ID: 1175709164

View in Genome Browser
Species Human (GRCh38)
Location 20:61205561-61205583
Sequence TGTCTAACCAGAATAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175709164_1175709169 0 Left 1175709164 20:61205561-61205583 CCTCCTTTTATTCTGGTTAGACA No data
Right 1175709169 20:61205584-61205606 TGGTTTGGTTCCCTTAGTTTGGG No data
1175709164_1175709170 1 Left 1175709164 20:61205561-61205583 CCTCCTTTTATTCTGGTTAGACA No data
Right 1175709170 20:61205585-61205607 GGTTTGGTTCCCTTAGTTTGGGG No data
1175709164_1175709175 20 Left 1175709164 20:61205561-61205583 CCTCCTTTTATTCTGGTTAGACA No data
Right 1175709175 20:61205604-61205626 GGGGATGGGTTGTGTTCTTTAGG No data
1175709164_1175709172 6 Left 1175709164 20:61205561-61205583 CCTCCTTTTATTCTGGTTAGACA No data
Right 1175709172 20:61205590-61205612 GGTTCCCTTAGTTTGGGGATGGG No data
1175709164_1175709171 5 Left 1175709164 20:61205561-61205583 CCTCCTTTTATTCTGGTTAGACA No data
Right 1175709171 20:61205589-61205611 TGGTTCCCTTAGTTTGGGGATGG No data
1175709164_1175709168 -1 Left 1175709164 20:61205561-61205583 CCTCCTTTTATTCTGGTTAGACA No data
Right 1175709168 20:61205583-61205605 ATGGTTTGGTTCCCTTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175709164 Original CRISPR TGTCTAACCAGAATAAAAGG AGG (reversed) Intergenic
No off target data available for this crispr