ID: 1175709517

View in Genome Browser
Species Human (GRCh38)
Location 20:61208050-61208072
Sequence CAGGCTGGATGTTAGGTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175709517_1175709527 5 Left 1175709517 20:61208050-61208072 CCCCGGACCTAACATCCAGCCTG No data
Right 1175709527 20:61208078-61208100 AATACTGGGTGTAGAAGGGCTGG No data
1175709517_1175709525 0 Left 1175709517 20:61208050-61208072 CCCCGGACCTAACATCCAGCCTG No data
Right 1175709525 20:61208073-61208095 CAGAAAATACTGGGTGTAGAAGG No data
1175709517_1175709521 -10 Left 1175709517 20:61208050-61208072 CCCCGGACCTAACATCCAGCCTG No data
Right 1175709521 20:61208063-61208085 ATCCAGCCTGCAGAAAATACTGG No data
1175709517_1175709522 -9 Left 1175709517 20:61208050-61208072 CCCCGGACCTAACATCCAGCCTG No data
Right 1175709522 20:61208064-61208086 TCCAGCCTGCAGAAAATACTGGG No data
1175709517_1175709526 1 Left 1175709517 20:61208050-61208072 CCCCGGACCTAACATCCAGCCTG No data
Right 1175709526 20:61208074-61208096 AGAAAATACTGGGTGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175709517 Original CRISPR CAGGCTGGATGTTAGGTCCG GGG (reversed) Intergenic
No off target data available for this crispr