ID: 1175714855

View in Genome Browser
Species Human (GRCh38)
Location 20:61248401-61248423
Sequence GAGGGTCAGGATTCTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175714848_1175714855 10 Left 1175714848 20:61248368-61248390 CCTGGATGGGGGCGTGTGCTTCT No data
Right 1175714855 20:61248401-61248423 GAGGGTCAGGATTCTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175714855 Original CRISPR GAGGGTCAGGATTCTGCTGG TGG Intergenic
No off target data available for this crispr