ID: 1175715745

View in Genome Browser
Species Human (GRCh38)
Location 20:61253193-61253215
Sequence TGCGTGTCCGGCGGGGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175715733_1175715745 4 Left 1175715733 20:61253166-61253188 CCCCGAGCCCTCGGCGGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1175715735_1175715745 3 Left 1175715735 20:61253167-61253189 CCCGAGCCCTCGGCGGGGCTGGA 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1175715738_1175715745 -4 Left 1175715738 20:61253174-61253196 CCTCGGCGGGGCTGGAGCCTGCG 0: 1
1: 0
2: 2
3: 23
4: 273
Right 1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1175715737_1175715745 -3 Left 1175715737 20:61253173-61253195 CCCTCGGCGGGGCTGGAGCCTGC 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1175715732_1175715745 5 Left 1175715732 20:61253165-61253187 CCCCCGAGCCCTCGGCGGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 154
Right 1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1175715736_1175715745 2 Left 1175715736 20:61253168-61253190 CCGAGCCCTCGGCGGGGCTGGAG 0: 1
1: 0
2: 1
3: 32
4: 267
Right 1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175715745 Original CRISPR TGCGTGTCCGGCGGGGCCCC GGG Intronic
900297175 1:1957650-1957672 CACGTGCCCGGCGAGGCCCCAGG - Intronic
900786773 1:4654665-4654687 GGCGCGGGCGGCGGGGCCCCGGG + Intergenic
901218139 1:7566197-7566219 TGCGAGCCGGGCTGGGCCCCTGG + Intronic
903182400 1:21611586-21611608 GGCGTGGCCTGGGGGGCCCCGGG - Intronic
904171042 1:28592428-28592450 GGCGGCGCCGGCGGGGCCCCGGG + Intronic
907325784 1:53637961-53637983 TGGGTGTCCAGCTGGTCCCCTGG - Intronic
908401401 1:63775012-63775034 TGCGAGGCCGCCGGAGCCCCAGG - Intronic
919640688 1:200041429-200041451 TGCCTGTCGGGAGGAGCCCCTGG + Intronic
922784611 1:228276757-228276779 TGCCTGTCCCGAGGGGGCCCCGG + Intronic
1064011954 10:11742623-11742645 TGTGTCTCCGGCGCGGCCCCTGG + Exonic
1064380698 10:14838788-14838810 TGGGTGTCCCGGGGGGTCCCGGG + Intronic
1070328308 10:75401744-75401766 TGCGTGTCCAGCCGGGGCTCTGG + Exonic
1073124343 10:101140354-101140376 TGCGTGTCCCGCCGCGCCGCGGG - Intergenic
1073207539 10:101776615-101776637 TGTGTGTCCCGCCGGGCCCCTGG + Intronic
1076454173 10:130578019-130578041 TGCGTGTGCCCAGGGGCCCCGGG - Intergenic
1079244669 11:18743582-18743604 TGCGTGCCCGGGGAGGCCTCAGG + Intronic
1080231021 11:30017461-30017483 TGCATCTCCGGCGAGGCCACGGG + Intergenic
1081705705 11:45180987-45181009 GGTGTGGCCAGCGGGGCCCCGGG + Intronic
1083572999 11:63769687-63769709 TGCGGGTCCCGGGGCGCCCCCGG + Intergenic
1085270100 11:75265183-75265205 TGGGTGTCCAGCGGGGGCCGAGG - Exonic
1090285555 11:125496151-125496173 GGGGTGTCCGGCTGAGCCCCGGG - Exonic
1090949780 11:131463467-131463489 TGTGTGGCCGCTGGGGCCCCAGG + Intronic
1093289057 12:17299989-17300011 TGCCTGACCGGCTGGGCCCCAGG - Intergenic
1096116877 12:49060159-49060181 CGCGGGGCCGGCGGGGCCGCGGG + Intergenic
1101353755 12:103957221-103957243 TTCCTGTCCGGTGCGGCCCCGGG - Exonic
1101504050 12:105330637-105330659 GGTGGGTCCGGCGGGTCCCCGGG + Exonic
1104829766 12:131742154-131742176 TATGTGTCAGGCAGGGCCCCAGG + Intronic
1106413330 13:29525932-29525954 TGGGTGGCCGGCGGGGCCTCTGG - Intronic
1108525207 13:51280596-51280618 GGCCTGTCCGGATGGGCCCCGGG - Exonic
1114269638 14:21092828-21092850 TGAGGGTCTGGCGCGGCCCCAGG - Exonic
1117424612 14:55580801-55580823 CGCGTCTCCGGCGGCGTCCCCGG + Intronic
1121050494 14:90816460-90816482 GGCGGGCGCGGCGGGGCCCCGGG + Intronic
1121108346 14:91295497-91295519 TGTGTGGCCGGGGGGGCCCCAGG + Intronic
1122893867 14:104745696-104745718 TGCGTGTCCCCCTGGGACCCTGG - Intronic
1123007454 14:105330671-105330693 TGGGTGTTGGGTGGGGCCCCAGG - Intronic
1126736706 15:51737816-51737838 TGCGTGTGCCGCGGGCGCCCGGG - Exonic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132864581 16:2087146-2087168 TGTCTGTCCGGCGCGGCCCTTGG + Intronic
1132904891 16:2277563-2277585 TGAGTGCCCAGTGGGGCCCCAGG + Intronic
1139402851 16:66696316-66696338 TAGGTGCCGGGCGGGGCCCCAGG - Intronic
1140069185 16:71634466-71634488 TGGGTGTCCTGCGGGTCCCGTGG + Intronic
1141132449 16:81445168-81445190 TGCTGGGGCGGCGGGGCCCCCGG - Exonic
1141620562 16:85234940-85234962 CGGGTCTCCGGCGGGGCCCAGGG - Intergenic
1141950016 16:87334089-87334111 GTCGTGGCCGGCAGGGCCCCCGG - Exonic
1141989491 16:87602272-87602294 TTCCAGTCCGGCGGGGGCCCCGG + Intronic
1142193052 16:88726662-88726684 AGCGGGGCCAGCGGGGCCCCAGG + Intronic
1143108262 17:4540113-4540135 TGAGGGTCCTGCGAGGCCCCTGG + Intronic
1144788368 17:17844233-17844255 TGCGTGTCTGCGGGGGCCCAGGG + Intronic
1144812353 17:18008619-18008641 TGGGTGTCTGTCTGGGCCCCAGG - Intronic
1145273062 17:21414834-21414856 TGCATGTCCTGGGGGGCCTCTGG + Intronic
1147585751 17:41653169-41653191 TGTGAGTCTGGCAGGGCCCCTGG - Intergenic
1149075877 17:52595868-52595890 TGCCTGACCAGCTGGGCCCCAGG - Intergenic
1149491249 17:57086181-57086203 CACGTGACCGTCGGGGCCCCCGG - Intronic
1149614586 17:57987832-57987854 TGTGTGTGCTGGGGGGCCCCCGG + Intronic
1150239911 17:63622838-63622860 TGCCTGTCAGGCGGTGGCCCAGG - Intronic
1150764646 17:67993608-67993630 GGCGTGGCCGGCGGAGCCCTCGG + Intronic
1150794360 17:68226067-68226089 TACGGGTCCGGCAGGGCTCCCGG - Intergenic
1151156126 17:72123905-72123927 TGCGGGGCCGGCGGGGCCTGTGG - Exonic
1151620276 17:75240851-75240873 TGCTTGTGCTGCTGGGCCCCAGG + Exonic
1152556350 17:81055057-81055079 TGCGTCTCTGCCGGCGCCCCCGG + Intronic
1154412481 18:14148866-14148888 CGCGTGTCCGGAGGGGCCAGGGG + Intergenic
1156350704 18:36298538-36298560 GGCGTCCCCGGCGGCGCCCCCGG - Intronic
1160024114 18:75204757-75204779 TCCGGGTCGGGCGGGGGCCCCGG + Intronic
1160500640 18:79399883-79399905 TGCGCGCCCTGCGGAGCCCCGGG - Intronic
1160523629 18:79522892-79522914 GGCTTGCCCAGCGGGGCCCCAGG + Intronic
1160825869 19:1080381-1080403 TGAGTGTCCGGCGGGGCCCAGGG + Intronic
1160916113 19:1497454-1497476 CGCCTGTCCGGCAGGGCCCAGGG + Exonic
1160955816 19:1691295-1691317 TGCCTGTCAGGCTGGGGCCCGGG + Intergenic
1161723093 19:5914449-5914471 TGCCTGTCCCGCGGGGCCTCGGG + Exonic
1162633276 19:11945555-11945577 TGCCTGACCGGCTGGGCCCCAGG + Intronic
1163480913 19:17555795-17555817 TCGGCGCCCGGCGGGGCCCCCGG - Exonic
1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG + Intronic
1163662639 19:18588007-18588029 TGCTCCTCCGGCTGGGCCCCTGG + Intronic
1165409604 19:35651194-35651216 TGGGTGTCAGCAGGGGCCCCAGG - Intronic
1165419975 19:35717864-35717886 CGCGTGGCCGGCCCGGCCCCCGG + Intergenic
1165761983 19:38326928-38326950 TACGTGCCCGGGGAGGCCCCTGG + Exonic
1166304317 19:41928882-41928904 TGCGTGTCCAGCAGGGGTCCTGG - Intronic
1167578477 19:50328914-50328936 CGCGTCCCCGGCGGGCCCCCCGG - Exonic
1167589240 19:50394307-50394329 TGCGTGTCCGGAGTGGCCACAGG - Intronic
931309714 2:61066292-61066314 TGCGCGCCCGGCCGCGCCCCGGG + Intronic
931698640 2:64890865-64890887 TGCCTGACTGGCTGGGCCCCAGG + Intergenic
935592466 2:104855353-104855375 GGCGGGGCCGGCGGGGGCCCGGG + Intergenic
947800779 2:232927731-232927753 TGCGGGCCCGACGGGGCCCGGGG + Intronic
948207480 2:236169900-236169922 TGGGTCTCCGGCGGGACTCCTGG - Intergenic
948801631 2:240435896-240435918 GGCGGGGCCGGCGGCGCCCCCGG - Exonic
948831978 2:240602692-240602714 GGAGTGGCCGGCGGTGCCCCAGG - Intronic
949042160 2:241854413-241854435 GGCGTGTGCGGCGTGGGCCCGGG + Intronic
1169145334 20:3248621-3248643 TGCGCGGCCAGCGGGGGCCCGGG + Intergenic
1169244482 20:4015209-4015231 GGAGGGTCCGGCGCGGCCCCGGG - Intronic
1175715745 20:61253193-61253215 TGCGTGTCCGGCGGGGCCCCGGG + Intronic
1176069003 20:63216344-63216366 GGCGTGTCCGGAGGCGCCGCGGG + Intergenic
1176860527 21:14009390-14009412 CGCGTGTCCGGAGGGGCCTGGGG - Intergenic
1178377186 21:32076517-32076539 TGCGAGGCCGGCGAGGCCCCAGG + Intergenic
1180970547 22:19812684-19812706 TGGCTGTCCAGCGTGGCCCCGGG + Intronic
1182296258 22:29312409-29312431 TGCGGGTCCGGAGGGGCGGCGGG - Exonic
1184525436 22:45020008-45020030 TCTGCTTCCGGCGGGGCCCCTGG + Intergenic
1184678185 22:46054547-46054569 TGCAGGTGCTGCGGGGCCCCCGG - Intronic
1184793016 22:46712784-46712806 TGGGAGTTTGGCGGGGCCCCTGG - Intronic
1184934213 22:47707170-47707192 TGTGTGTCCGATGGGGCCTCGGG + Intergenic
1185365790 22:50436168-50436190 CGCGTGTCCGGAGGGGCCTGGGG - Intronic
952990056 3:38823950-38823972 TGGGTGTCCTGCTGGGCCCTGGG + Intergenic
954117215 3:48473495-48473517 TGTGTGTCAGCCAGGGCCCCAGG - Intronic
955167556 3:56529278-56529300 TGCGTGGCTGGCGAGGCCTCAGG + Intergenic
961473861 3:127135185-127135207 TGCATGTCCTGCTGTGCCCCCGG + Intergenic
963335974 3:143973126-143973148 GGCGTCTCCGGGGGAGCCCCGGG + Intronic
968481671 4:835748-835770 TGAATGTCCTGAGGGGCCCCCGG - Intergenic
968552195 4:1229484-1229506 CACCTGTCCAGCGGGGCCCCAGG + Intronic
968575891 4:1365981-1366003 TGCGAGGGCGGCGGTGCCCCCGG - Intronic
969564787 4:7971342-7971364 TGCTTGTCCTGCGCGGGCCCTGG - Intronic
978189370 4:105895286-105895308 TGCCTGCCCCGCTGGGCCCCCGG + Intronic
978282787 4:107036992-107037014 TACGAGTGCGGCGGGGCCCGGGG - Intronic
981604742 4:146529023-146529045 TGCCTAACCGGCTGGGCCCCAGG - Intergenic
987308941 5:16664455-16664477 TGGGTGCCTGGCGGGGCCACAGG + Intronic
998186793 5:139986281-139986303 TATGTGTCAGGCGTGGCCCCTGG + Intronic
1002298002 5:178241924-178241946 TGCGTGACCAGTGGGGCCTCTGG + Intronic
1003263902 6:4549785-4549807 TGCGTTTCAGGCGGTGCTCCGGG - Intergenic
1003306522 6:4933918-4933940 TGCGTGGCAGGCGAGGCCCAAGG - Intronic
1008967660 6:57329697-57329719 TGCGTGTCTGGGGAGGCCTCAGG - Intronic
1010083075 6:71886641-71886663 GGCGTCTCCGGCGGGGCGCGGGG - Intergenic
1011228859 6:85137510-85137532 TGCCTGTCCCGCGGAGCCCTAGG - Intergenic
1012611942 6:101228737-101228759 TGTCTGTCTGGCTGGGCCCCAGG + Intergenic
1015071969 6:129105252-129105274 TGCATGTCCAGCAGTGCCCCAGG + Intronic
1018055379 6:160047836-160047858 TGCCTGCCCGGAGGAGCCCCTGG + Exonic
1019435497 7:1020314-1020336 GGCGTGCTGGGCGGGGCCCCAGG - Intronic
1019535877 7:1529795-1529817 TGGGTGTCCTGGGGGGCCCTCGG + Intergenic
1024219301 7:47275490-47275512 TGCCTGTCCAGCGGGAGCCCTGG + Exonic
1024355585 7:48410647-48410669 TGAGTGTCAGGCGGAGCCCCTGG - Exonic
1024929829 7:54658296-54658318 TGTGTGTCCGGCAGAGCCCCAGG - Intergenic
1028160090 7:87475645-87475667 CGCGTGTCTGGCAGGGCCTCTGG + Exonic
1031287884 7:119895239-119895261 TGCTTGGCTGGGGGGGCCCCAGG + Intergenic
1036816874 8:11908932-11908954 TGCGTAACCAGCTGGGCCCCAGG + Intergenic
1036820172 8:11933821-11933843 TGCATAACCGGCTGGGCCCCAGG + Intergenic
1038798862 8:30731734-30731756 TGCCTAACCGGCTGGGCCCCGGG - Intergenic
1039278121 8:35954637-35954659 TTCCTGACCGGCTGGGCCCCAGG - Intergenic
1039446563 8:37637723-37637745 GGCGTGTCCAACAGGGCCCCTGG + Intergenic
1042518967 8:69690044-69690066 TGCGGGTACGGGGGGGCGCCAGG + Intronic
1043617851 8:82149235-82149257 TGCATGTCTGGGGAGGCCCCCGG - Intergenic
1049204598 8:141357893-141357915 TGTGTCTCCAGCGGGGCCCTCGG - Exonic
1049608018 8:143538709-143538731 TGACTGTCCGGCGGGGCTCCCGG + Exonic
1059176710 9:112175087-112175109 CGGGCGGCCGGCGGGGCCCCCGG - Intronic
1062138808 9:134944231-134944253 TCCGTCTCCTGCAGGGCCCCAGG - Intergenic
1062224431 9:135441453-135441475 TGCCTAACCGGCTGGGCCCCAGG + Intergenic
1187281292 X:17860485-17860507 TGAGTGTGCGTCGGCGCCCCGGG - Intronic
1190315135 X:49145840-49145862 TGCCTGACCAGCTGGGCCCCAGG + Intergenic
1200141681 X:153905697-153905719 GGCGGGGCCGGCGGGGCCACTGG + Exonic