ID: 1175716316

View in Genome Browser
Species Human (GRCh38)
Location 20:61256528-61256550
Sequence TGTGCTCTTGATCAGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175716312_1175716316 -7 Left 1175716312 20:61256512-61256534 CCAGGCCAAACCGTGCTGTGCTC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG 0: 1
1: 0
2: 1
3: 22
4: 162
1175716311_1175716316 1 Left 1175716311 20:61256504-61256526 CCAGTGGTCCAGGCCAAACCGTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG 0: 1
1: 0
2: 1
3: 22
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175716316 Original CRISPR TGTGCTCTTGATCAGTGTGG TGG Intronic
904598260 1:31660098-31660120 AGTGCCTTTGATCAGTGTGACGG - Intronic
904662316 1:32094555-32094577 TGTTCTCTGGCTCAGAGTGGTGG + Intronic
906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG + Intronic
907418374 1:54330007-54330029 AGTGCTATTCATCAGTATGGTGG - Intronic
907870805 1:58441090-58441112 TGTGCTCTTTGTCAATGTGCAGG - Intronic
907908101 1:58803101-58803123 TGAGCTGTTTATCATTGTGGAGG + Intergenic
910862731 1:91758574-91758596 TGTGCTAAGGATCAGTTTGGGGG + Intronic
912980604 1:114368266-114368288 TGTCCTCTTAAGCACTGTGGGGG + Intergenic
913159706 1:116133750-116133772 TGTGCCCATGATCAGTGGGCTGG - Exonic
915348122 1:155208362-155208384 AGTGCTCTTTATTAGGGTGGGGG + Intronic
916288936 1:163142183-163142205 TGCGCTCTTGATCAATTGGGAGG - Intronic
917653963 1:177107371-177107393 TGTGCTCAGGATAAATGTGGTGG + Intronic
918558233 1:185830945-185830967 TGTGCTTTTGATGATAGTGGGGG - Intronic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
920208828 1:204313469-204313491 TGTGCTCTTGAGAAATGGGGAGG - Intronic
921300210 1:213744795-213744817 TGTGCTGCTGGTCAGCGTGGAGG + Intergenic
923256248 1:232223954-232223976 TGTGAGCGTGACCAGTGTGGAGG - Intergenic
1063628038 10:7709086-7709108 TTTGCTCTGGATCATGGTGGTGG - Exonic
1064514563 10:16132184-16132206 TATGGTCTTGTTCAATGTGGTGG - Intergenic
1066281680 10:33923886-33923908 TGAGCTCTTGTTCAGTGTCCAGG - Intergenic
1067024112 10:42828486-42828508 TGTGCTCTGCTTCAGTGTGGAGG + Intronic
1067692227 10:48509239-48509261 TGTGCTCCTGGCCAGCGTGGGGG + Intronic
1068044240 10:51864954-51864976 TGTGCTCTTGATAATTGTCTTGG + Intronic
1070815063 10:79317678-79317700 TGTGCCTTAGAGCAGTGTGGTGG + Intergenic
1072424075 10:95314526-95314548 TTTGGTCTTGGGCAGTGTGGGGG + Exonic
1074249543 10:111730835-111730857 TGTGCTATTGAAGAGTGAGGAGG + Intergenic
1076190846 10:128482356-128482378 TGTGCCCTTGTTCAGCCTGGTGG - Intergenic
1077116487 11:887389-887411 TGTGCTCTTGGTCAGTGGTGTGG + Intronic
1077240554 11:1508361-1508383 TGCGCTCTGGAACAGTGCGGGGG + Intergenic
1083190484 11:61048451-61048473 TGTGCTTTGCAGCAGTGTGGGGG - Intergenic
1083363149 11:62125104-62125126 AGTGCTCTTTATCTGTGTGCAGG + Intronic
1085593684 11:77789550-77789572 TCAGCTCCTGATCAGTCTGGGGG - Intronic
1087894603 11:103573325-103573347 TGTTCTCTTAACCACTGTGGCGG - Intergenic
1088607449 11:111545126-111545148 TGTGCACCTGATCAGTGTAATGG - Intronic
1089177298 11:116558056-116558078 TGTGCTCTTGCTCACAGTGGTGG - Intergenic
1089689980 11:120181105-120181127 TCTGCTCTTGATGTGTCTGGGGG + Intronic
1090648958 11:128789715-128789737 TGAGCTGGTGCTCAGTGTGGAGG + Intronic
1093075475 12:14753617-14753639 TGTGCCTTTGATTGGTGTGGGGG - Intergenic
1093288751 12:17298123-17298145 TGTCCTCTTAACCACTGTGGTGG - Intergenic
1094194389 12:27731273-27731295 TGTGCTTTTGATTTGTCTGGAGG + Intronic
1094528572 12:31250439-31250461 TTGGTTCTTGAGCAGTGTGGCGG + Intergenic
1094851556 12:34384527-34384549 TCTGCACTTGAGCAGTGGGGAGG + Intergenic
1096158704 12:49358760-49358782 TTTTCTCTTGAACAGTGGGGTGG + Intergenic
1097210249 12:57362604-57362626 TTGGCTCTTGAACAATGTGGGGG - Intronic
1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG + Intergenic
1100757929 12:97772968-97772990 TGTGCTCTTGTTCAGTGTCCAGG + Intergenic
1101029780 12:100647338-100647360 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1101764104 12:107682654-107682676 TGTGCTCTTGGTGGGAGTGGCGG - Intergenic
1106005815 13:25769389-25769411 TGTGATCTTGTGCAGTTTGGAGG + Intronic
1106052874 13:26207859-26207881 TCTGCTCTGCATCCGTGTGGGGG - Intronic
1108025735 13:46175395-46175417 TGGGCTCTTGGTAAATGTGGAGG - Intronic
1111335754 13:86820103-86820125 TGTGGGCCTGATCATTGTGGAGG - Intergenic
1118163493 14:63313879-63313901 TGTGGTATTGATCAGTGCTGTGG - Intronic
1119161685 14:72458130-72458152 ATTGCCCTTGCTCAGTGTGGGGG - Intronic
1123425262 15:20165526-20165548 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1123534486 15:21172060-21172082 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1126449241 15:48787496-48787518 TGTGAATTTGATCAATGTGGAGG - Intronic
1127593071 15:60446731-60446753 TCTACTATTGATCATTGTGGAGG - Intronic
1128049515 15:64651609-64651631 TCAGCTCCTGTTCAGTGTGGGGG + Intronic
1128678038 15:69626172-69626194 TGGGCTCTGGCCCAGTGTGGAGG + Intergenic
1130262041 15:82362877-82362899 TGTCCCTTTGACCAGTGTGGGGG + Intergenic
1130279191 15:82506130-82506152 TGTCCCTTTGACCAGTGTGGGGG - Intergenic
1130314214 15:82781419-82781441 TGTACTCTTGGACAATGTGGGGG + Intronic
1136411172 16:30078117-30078139 CGGGCCCTGGATCAGTGTGGTGG + Intronic
1136859596 16:33690217-33690239 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1141833694 16:86524277-86524299 TGTTTTCCTGAGCAGTGTGGTGG + Intergenic
1203121102 16_KI270728v1_random:1538396-1538418 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1142684866 17:1571934-1571956 TGGGGTTTTGATCAGTGAGGAGG - Intronic
1143494950 17:7307524-7307546 TGTGCGCTTGCGCAGTGCGGGGG + Intronic
1147592324 17:41692134-41692156 TGTGCTGTTAATCAGTGTCCTGG + Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1153882572 18:9434099-9434121 TGTGCTCTTGGGGAGTGAGGAGG - Intergenic
1153894040 18:9543102-9543124 TGTGTTCGTGTGCAGTGTGGGGG - Intergenic
1154979367 18:21489892-21489914 GGGGCTACTGATCAGTGTGGTGG - Intronic
1158291707 18:55951669-55951691 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1158527389 18:58227394-58227416 CGTGATTTTGGTCAGTGTGGAGG + Intronic
1159160555 18:64638672-64638694 TGTGCTCTAGTTCATTTTGGAGG + Intergenic
1161573605 19:5043571-5043593 TGTGGTGTTTATCAGAGTGGGGG + Intronic
1163103010 19:15108974-15108996 TGTGCAATTGATCAGTGGGTGGG - Intronic
925136701 2:1528078-1528100 TGTGCTTTTGCTCACAGTGGGGG - Intronic
925136750 2:1528273-1528295 TGTGTTTTTGCTCACTGTGGGGG - Intronic
926701440 2:15806802-15806824 TGTGCTCTTGAGCACAGAGGAGG + Intergenic
928112556 2:28522384-28522406 TGTGGTGTTGGTCAGGGTGGGGG + Intronic
929964119 2:46520968-46520990 TGTTCTCTTGATCTGGATGGTGG - Intronic
930240315 2:48929453-48929475 GTTTCTCTTGATGAGTGTGGTGG + Intergenic
930517965 2:52432045-52432067 TGTCCTCTTAACCACTGTGGGGG - Intergenic
934457958 2:94191327-94191349 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
937877110 2:126834079-126834101 TTTGCTGTTGATGATTGTGGTGG - Intergenic
939578246 2:143920795-143920817 TCTGCCCTTACTCAGTGTGGTGG - Intergenic
940073789 2:149718498-149718520 TGTTCTCTTGCTCTGTGAGGAGG + Intergenic
941674467 2:168328929-168328951 TGTGCTCTGGCACAGTGTGTTGG - Intergenic
944389797 2:199206182-199206204 TGTGTTTTTGATCTGTGTCGAGG + Intergenic
1168833322 20:859403-859425 TGTGTTCTTGATGTGTTTGGGGG + Intergenic
1170034085 20:11971821-11971843 TTGACTCTTGAACAGTGTGGAGG - Intergenic
1174034401 20:47659273-47659295 TGTTCTCATGATGAGGGTGGGGG - Intronic
1174481165 20:50832543-50832565 TGTGTTGTGGATGAGTGTGGTGG - Intronic
1175380322 20:58558240-58558262 TGAGCTTTTAATCAGTGTAGGGG - Intergenic
1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG + Intronic
1175786006 20:61712211-61712233 TTTGGACTTGATCCGTGTGGTGG + Intronic
1175968868 20:62673920-62673942 TGTGCTGTTGCCCAGTGTGTTGG - Intronic
1180729293 22:17969607-17969629 TGGGCCCTTGATCTGTGAGGAGG + Intronic
1185168946 22:49280811-49280833 TGTACACTTGCTGAGTGTGGCGG - Intergenic
949157592 3:847883-847905 TGTCCTCTTAACCACTGTGGTGG - Intergenic
949260150 3:2096533-2096555 TTAGCACTGGATCAGTGTGGGGG + Intergenic
952144919 3:30521855-30521877 TGTGCTCTTGCTCAGATTGCTGG - Intergenic
953984588 3:47431695-47431717 TGTGCCCTTGATATGTGAGGAGG - Intronic
958111722 3:89156464-89156486 TCTTCTCTTAATCTGTGTGGAGG + Intronic
961710290 3:128823272-128823294 TGGGCTCTGAATCAGGGTGGGGG + Intergenic
962026920 3:131557427-131557449 TGAGCTCTTAATCAGTCAGGTGG - Intronic
964226507 3:154408929-154408951 TGTGTTTTTGTTCAGTGTGCTGG - Intronic
969907850 4:10414049-10414071 TGTGCTCTTGTTCCAGGTGGAGG + Intergenic
972705079 4:41534432-41534454 TTTGGACTTGAGCAGTGTGGAGG + Intronic
978892352 4:113845279-113845301 TGTGCTCTTTCTCAATGAGGAGG - Intergenic
980192322 4:129540880-129540902 GGTGCTCTTGATAAGTGGAGTGG + Intergenic
980603563 4:135059145-135059167 TGAGCTCTTGTTCAGTGTTCAGG - Intergenic
981270382 4:142839930-142839952 TGTCCTCAAGATCAATGTGGTGG - Intronic
982447559 4:155511432-155511454 TGTGCTCTTAATCATTGCTGAGG + Intergenic
982567425 4:157003369-157003391 TGTGCCCTTTCTGAGTGTGGAGG + Intergenic
986219831 5:5758121-5758143 TCTGCTCTTCATAAGTCTGGTGG + Intergenic
987073386 5:14358688-14358710 TGTGCTCTAGATCAGCCTGAGGG - Intronic
987289348 5:16493815-16493837 GGTGCTCAGGACCAGTGTGGTGG - Intronic
990422103 5:55646086-55646108 TATGCTCTGGCTGAGTGTGGTGG + Intronic
993863270 5:93161507-93161529 TGTGATCTTTAGCAGTGAGGTGG - Intergenic
995473316 5:112525163-112525185 TGTCCTCTTAACCACTGTGGGGG - Intergenic
999133190 5:149299946-149299968 TGTGTTGTAGGTCAGTGTGGGGG - Intronic
999564472 5:152841940-152841962 TGAGCTCAAGATCAGGGTGGAGG - Intergenic
1004414666 6:15414733-15414755 TTTTCTTTTGATCATTGTGGTGG + Intronic
1006052573 6:31355795-31355817 TCTGCTCCTGATCTGAGTGGAGG + Intronic
1006086708 6:31600844-31600866 TGGGCTCTTGATGAATGTGAGGG - Intergenic
1007173674 6:39882131-39882153 TGGGCTCTTGGCCAGAGTGGTGG + Intronic
1007197522 6:40075500-40075522 GGTCTTCCTGATCAGTGTGGGGG - Intergenic
1007804611 6:44431313-44431335 TGTGCTGTTGCTCTGTGTTGTGG + Intronic
1008780719 6:55101330-55101352 GGTGGTTTTGACCAGTGTGGTGG - Intergenic
1009524654 6:64728789-64728811 TGAGCTCTTGTTCAGTGTCCAGG + Intronic
1011025120 6:82860306-82860328 TGTGATTTTGAACTGTGTGGTGG - Intergenic
1014264258 6:119257145-119257167 TGTGCTCTGGATTAATGTGGAGG + Intronic
1014547272 6:122747968-122747990 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1015440799 6:133243120-133243142 TGTGTACTTGATCTGTGAGGAGG + Intronic
1016341125 6:143062095-143062117 TGTTCTCTTCATCAGAATGGAGG - Intronic
1017091892 6:150766501-150766523 TGTACTTATGATCAGTGGGGGGG + Intronic
1017577056 6:155816800-155816822 TGTGCTCCTGAGCAGAATGGTGG - Intergenic
1019502152 7:1369701-1369723 TGGGCGATGGATCAGTGTGGGGG - Intergenic
1019571741 7:1716058-1716080 TGTGCTCTTCCTCAGTGAGTTGG + Intronic
1020258025 7:6513173-6513195 TGTGCTCATGATCCTGGTGGTGG + Intronic
1023010862 7:35923884-35923906 TGTTCTGTTGATCAGTTTGGAGG + Intergenic
1023238559 7:38116923-38116945 TGAACCCTTGATCAGTGGGGGGG + Intergenic
1024062787 7:45711134-45711156 TCTGCTTTTCCTCAGTGTGGAGG + Intronic
1024080260 7:45849957-45849979 TGTTCTGTTGATCAGTTTGGAGG - Intergenic
1024528796 7:50373281-50373303 TGTGCTGTTGATCAGTGTGTGGG - Intronic
1025124496 7:56333983-56334005 TGTTCTGTTGATCAGTTTGGAGG + Intergenic
1027543377 7:79496561-79496583 TGTGCACTTCATCAGTGTTTTGG + Intergenic
1027912075 7:84263229-84263251 TGTGCTCTTATTCAGTCTTGCGG + Intronic
1027951901 7:84826835-84826857 TGTTCTGTTGATCAGGCTGGAGG - Intergenic
1029842241 7:103377713-103377735 TGTGCTTTTGATCACTATTGGGG + Exonic
1032093687 7:128926523-128926545 AGTGCTCCTGATCAGTGTGCTGG + Intergenic
1032170430 7:129579680-129579702 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1033280995 7:140006278-140006300 TGAGCTCTTGAGCAGGGTGTGGG - Intronic
1033564770 7:142567701-142567723 TGAGCTCTTGACCAGTGTACTGG - Intergenic
1034368494 7:150572442-150572464 TGTGCTCTTCCTCAGTGTAACGG - Exonic
1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG + Intergenic
1041788173 8:61659084-61659106 TGTGCTCCTGCTCTGTGTGGTGG - Intronic
1044843100 8:96354856-96354878 TGTGCTCTTGGTGAGTGTTCGGG + Intergenic
1045734046 8:105274695-105274717 TGTGTTAATGATCAGTGTTGGGG + Intronic
1051027651 9:12632734-12632756 TGTCCTCTTCATTAGAGTGGAGG + Intergenic
1053688466 9:40567132-40567154 TGTGTTCTGCTTCAGTGTGGAGG - Intergenic
1054275564 9:63063926-63063948 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1054299707 9:63368043-63368065 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054399269 9:64701005-64701027 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054432848 9:65185270-65185292 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054497537 9:65836405-65836427 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1054855309 9:69893012-69893034 TGAGCTCTTGTTCAGTGTCCAGG - Intronic
1060157809 9:121332230-121332252 TGTGTTCCTGAGCAGGGTGGTGG + Intronic
1060515953 9:124265969-124265991 GGTGCTCTTGATCAATTTGCAGG + Intronic
1062037281 9:134388231-134388253 TGTGCTCTTCGTCAGGGTTGGGG + Intronic
1062045788 9:134423888-134423910 TGTTCTCTGGATCGGTCTGGTGG - Intronic
1062733537 9:138121969-138121991 AGTGGTCTTGGTCAGGGTGGTGG - Exonic
1185820657 X:3200511-3200533 TTTACTCTTGAACAATGTGGGGG - Intergenic
1185860008 X:3569068-3569090 GGTGCTTTTGATGTGTGTGGTGG - Intergenic
1185909437 X:3968690-3968712 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1186965542 X:14782803-14782825 TGGGCTCTTGATTAGTCGGGGGG + Intergenic
1188627093 X:32298250-32298272 GGTGCTTTGGATCAGAGTGGAGG + Intronic
1190426368 X:50337420-50337442 TGTCCTCTTAACCACTGTGGGGG + Intronic
1193817494 X:86121870-86121892 TGTGTTTTTGTTCAGTGTGTTGG + Intergenic
1198739557 X:139826816-139826838 TTTTCTCTTGGTCAGTGTGCTGG - Exonic
1201270195 Y:12246769-12246791 TGTCCTCTTAACCACTGTGGGGG - Intergenic