ID: 1175718118

View in Genome Browser
Species Human (GRCh38)
Location 20:61269031-61269053
Sequence GAACCCCATGGAAAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175718113_1175718118 26 Left 1175718113 20:61268982-61269004 CCTGCAAATGTGATGAGGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1175718118 20:61269031-61269053 GAACCCCATGGAAAGCCCTGTGG 0: 1
1: 0
2: 3
3: 30
4: 173
1175718116_1175718118 -7 Left 1175718116 20:61269015-61269037 CCTTGGGTGAGCATCAGAACCCC 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1175718118 20:61269031-61269053 GAACCCCATGGAAAGCCCTGTGG 0: 1
1: 0
2: 3
3: 30
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175718118 Original CRISPR GAACCCCATGGAAAGCCCTG TGG Intronic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
901161399 1:7178838-7178860 GAAAACCAAGGAAATCCCTGAGG - Intronic
901691839 1:10978723-10978745 GAGTCCCATGCAAAGACCTGGGG + Intronic
902148448 1:14422830-14422852 GAACCATAAGGAAAGCCTTGGGG - Intergenic
902300000 1:15494964-15494986 AATTCCCATGGAAACCCCTGAGG + Intronic
904187169 1:28714515-28714537 GACCACCATGGTTAGCCCTGTGG + Exonic
904282802 1:29433198-29433220 CAAGCCCATGGAAAGACATGAGG - Intergenic
904314147 1:29649515-29649537 GAACCCCTGGGCAAGACCTGCGG + Intergenic
904488680 1:30844576-30844598 GGGTCCCAAGGAAAGCCCTGAGG - Intergenic
907333715 1:53687351-53687373 GAACTCCATGGGAATCCCTTAGG - Intronic
910196470 1:84645606-84645628 GTACACCATGGAAAACCCTCGGG + Exonic
910426663 1:87125700-87125722 GAAGCCCCTGGAAGGCCCAGTGG - Intronic
910457211 1:87410901-87410923 ATACCCTATGGATAGCCCTGTGG + Intergenic
915724704 1:158008988-158009010 AAAGCCCAAGGAAAGCCCCGAGG - Intronic
920606436 1:207392502-207392524 GCAGCACATGCAAAGCCCTGGGG + Intergenic
922579447 1:226686122-226686144 GAACCCAAGGGAAAGCCATGTGG + Intronic
1064144884 10:12819553-12819575 TAACCCCTTGAAAAGTCCTGCGG - Intronic
1064980916 10:21165776-21165798 GAACCCCAGGGAAAGGTGTGGGG + Intronic
1067771292 10:49128230-49128252 GAAGCCCATGGAAAGCACCATGG + Intergenic
1069669507 10:70189849-70189871 AGACACCATGCAAAGCCCTGGGG - Intergenic
1071218728 10:83437452-83437474 CAACCTCATGAAAAGGCCTGGGG + Intergenic
1074199893 10:111225335-111225357 GAAACCCATGTAAACCACTGGGG + Intergenic
1074363623 10:112841146-112841168 TATCCCCTAGGAAAGCCCTGGGG - Intergenic
1075323345 10:121510214-121510236 GAGTCCCAGGGAAAGGCCTGCGG - Intronic
1075551163 10:123393755-123393777 TAAACCCATGGAAAGGCCTGGGG - Intergenic
1075742682 10:124705447-124705469 GCACGCCAGGGAAAGCCTTGCGG - Intronic
1075992143 10:126847111-126847133 GAGCCACATGGAAACCCCTGTGG + Intergenic
1077541208 11:3147316-3147338 CAGGCCCATGGCAAGCCCTGTGG - Intronic
1081826088 11:46053573-46053595 GAACCCCATGCTGAGCCATGGGG - Intronic
1083969647 11:66066933-66066955 GAGACTCATGGAGAGCCCTGAGG - Intronic
1084318185 11:68357890-68357912 GAACGCCTTCAAAAGCCCTGGGG - Intronic
1084670320 11:70603088-70603110 AAACCCCAAGGAAAATCCTGAGG + Intronic
1084900890 11:72309018-72309040 GAAGCCCATGGCAGGCCCTTGGG + Intronic
1087345086 11:96961992-96962014 GAAACATATGCAAAGCCCTGAGG + Intergenic
1088924055 11:114282725-114282747 GAATCCAATGGAAGGCTCTGGGG + Intronic
1089625969 11:119751347-119751369 GAAGCCCATGAAGAGCCCTTTGG + Intergenic
1089788349 11:120924045-120924067 GAACACCAGGCAAAGCCCAGGGG - Intronic
1090169664 11:124589310-124589332 GAATACCATGGAAAATCCTGGGG + Intergenic
1092428238 12:8390442-8390464 GAAGCCCCTGGCAAGCCCCGAGG - Intergenic
1092444786 12:8544518-8544540 AAAGCCCTTGTAAAGCCCTGTGG - Intergenic
1092551092 12:9500915-9500937 GAACCCAATGAAAAGCCCTCAGG - Intergenic
1094520724 12:31185464-31185486 GAACCCAATGAAAAGCCCTCAGG + Intergenic
1097013724 12:55970906-55970928 TGACCCCATGAAAGGCCCTGGGG + Intronic
1101005045 12:100393253-100393275 GATCCCTGTGGAAATCCCTGTGG - Intronic
1102527774 12:113524313-113524335 GGACCTCATGGAAAGTCCCGAGG + Intergenic
1106036534 13:26050192-26050214 GCAGCCCCGGGAAAGCCCTGAGG + Intronic
1106144826 13:27041176-27041198 GAAAGCCATGGAGAGCCCTGGGG - Intergenic
1107690448 13:42948053-42948075 GAACACCGTGGAGAGCGCTGTGG - Intronic
1107717809 13:43217758-43217780 GAAACACAGGGAATGCCCTGAGG + Intronic
1108518120 13:51221957-51221979 GAACCTCGTGGCAAGCCCTGGGG + Intergenic
1111699042 13:91662665-91662687 GAACCAAATGAAAATCCCTGGGG - Intronic
1111741274 13:92208263-92208285 GGACCCCATGGAAATCACTCTGG - Intronic
1112324806 13:98436805-98436827 GAACCCTCAGAAAAGCCCTGTGG + Intronic
1114066771 14:19066730-19066752 GGACACCATGGAAAGCAATGTGG - Intergenic
1114095495 14:19333297-19333319 GGACACCATGGAAAGCAATGTGG + Intergenic
1115706019 14:35998836-35998858 GGACCCCATGGAAATCCAGGTGG + Intergenic
1116427753 14:44810895-44810917 GAAGCACATGGAAAGATCTGTGG - Intergenic
1116499663 14:45605377-45605399 GAACCCAGTGAAAAGCCCTCAGG - Intergenic
1121302755 14:92885145-92885167 TGACCCCATGGAAAGCTCTGGGG - Intergenic
1122148319 14:99707391-99707413 GATCCCCATGGAATGCTATGAGG - Intronic
1122720105 14:103716744-103716766 GAACCCCACGGGAGGCCCAGCGG - Intronic
1122965822 14:105125140-105125162 GAACCCCATGGAAATCCATCTGG + Intergenic
1124138637 15:27057567-27057589 GAGCCCCCTGGAAAGGCCTCTGG + Intronic
1124231213 15:27947721-27947743 CAACCCCACAGACAGCCCTGAGG + Intronic
1124953586 15:34345134-34345156 GAACCCCAGGGAAGGCCTTTTGG + Intronic
1125726332 15:41870135-41870157 GAGGCCCATGGGAGGCCCTGAGG + Intronic
1125756982 15:42070985-42071007 GATCCCCTTGGAAGGTCCTGGGG - Intronic
1126932125 15:53666141-53666163 GAAACCCAGGCAAAGCACTGTGG - Intronic
1127702492 15:61514699-61514721 GGACCCCATGGGGAGCTCTGGGG + Intergenic
1128838576 15:70831277-70831299 GAAGCCCAAGGAGAGCCCTGGGG + Exonic
1135673372 16:24393563-24393585 GAAGCCCATGGAAGGCTCTTGGG - Intergenic
1137654986 16:50152579-50152601 GTACCCCATGCATAGCCCTGGGG - Intergenic
1137766258 16:50979816-50979838 GCACCTCATGGGAAGCCCTGGGG + Intergenic
1140032258 16:71348280-71348302 GGATCCCATGGGAAGCTCTGGGG + Intergenic
1144166352 17:12614854-12614876 TGACCCCATGGAAAGTCCTGGGG + Intergenic
1145024060 17:19454329-19454351 GACCCCCATGGAAGGGCCTCAGG + Intergenic
1145252765 17:21305359-21305381 GAACTCCAGAGAAAGCCCTGTGG - Intronic
1145323809 17:21782550-21782572 GAACTCCAGAGAAAGCCCTGTGG + Intergenic
1147514175 17:41100568-41100590 GAACCCCGGGGACAGGCCTGAGG + Intronic
1147516270 17:41120787-41120809 GAACCCCAGGGACAAGCCTGAGG + Intergenic
1151620652 17:75242956-75242978 GTACCCCAGGGAAACCCCAGAGG + Intronic
1155276043 18:24188351-24188373 CAAGCCCCTGGAAAGCCCGGTGG - Intronic
1155545031 18:26905926-26905948 GCAGCCCATAGAAAGCCCTGAGG + Intergenic
1158465705 18:57688124-57688146 GAGCACCATGGACAGCACTGGGG - Intronic
1160259176 18:77275134-77275156 GAACCCCATGCAAGGCCCTCAGG - Exonic
1160347274 18:78144028-78144050 GACACCCAGAGAAAGCCCTGTGG + Intergenic
1161281433 19:3447803-3447825 GCACCCCCTGGAAAGCCCCTGGG - Intronic
1161594962 19:5146405-5146427 CATCCCCATGGCCAGCCCTGTGG + Intronic
1162814258 19:13183782-13183804 GCACCCCATGAGAAGCCCTGTGG + Intergenic
1167163091 19:47780272-47780294 GCACTCCAAGGAAAACCCTGCGG - Intronic
925392183 2:3502984-3503006 GAAGGCAAAGGAAAGCCCTGTGG + Intronic
926227465 2:10978552-10978574 GGGGCCCAGGGAAAGCCCTGTGG + Intergenic
927004904 2:18838080-18838102 GAACTTCATGGGAACCCCTGTGG - Intergenic
928366113 2:30704786-30704808 AAACCCCATGGGAATCTCTGAGG - Intergenic
929724864 2:44414493-44414515 GAACCTCATGGAAGGCCCACAGG - Intronic
931569718 2:63656049-63656071 GAACCTCTTTGCAAGCCCTGTGG + Intronic
931686808 2:64800818-64800840 GAACCCCATGTCAAGCACTCTGG + Intergenic
932432417 2:71683906-71683928 GAACTGCATGGAAAGCTGTGTGG - Intronic
938070814 2:128307239-128307261 GATCTCCAGGGAAGGCCCTGGGG + Intronic
938484169 2:131686825-131686847 GGACACCATGGAAAGCAATGTGG - Intergenic
940215551 2:151299895-151299917 TAGCCCCATGAAAAGTCCTGCGG - Intergenic
941184050 2:162298975-162298997 GAGCTCCATGGATAGCCATGTGG - Intronic
944901530 2:204221504-204221526 GAACCCCATGGACAGTCTTCAGG - Intergenic
945933539 2:215880597-215880619 CAACCCCATGGGCAGCTCTGTGG + Intergenic
947027948 2:225760121-225760143 GAGCTTCATGGAAAGGCCTGAGG - Intergenic
948274236 2:236695805-236695827 GAGGTCCATGGAAAGACCTGGGG + Intergenic
948280449 2:236743266-236743288 GAGCTCCCTGGAAAGGCCTGAGG + Intergenic
1169605323 20:7311428-7311450 TAACCACATGGAAAGCCTTGCGG - Intergenic
1172627231 20:36354189-36354211 GAACCCCAGGGAAAGGCCAGGGG - Intronic
1172938063 20:38634796-38634818 CCAGCCCAGGGAAAGCCCTGTGG + Intronic
1173613893 20:44390408-44390430 GAGCCCCTTGCAGAGCCCTGGGG + Intronic
1174862995 20:54110073-54110095 GGCCTCCATGGAAGGCCCTGGGG - Intergenic
1175718118 20:61269031-61269053 GAACCCCATGGAAAGCCCTGTGG + Intronic
1176253426 20:64138064-64138086 GCTCCCCATGGACAGCCCTGGGG - Intergenic
1178381452 21:32113127-32113149 GATCCTCATGGAAACCCCAGAGG + Intergenic
1179282023 21:39941829-39941851 GAACCCTATGGAAAGCCACTGGG - Intergenic
1180107622 21:45630292-45630314 GAACACCATGGAGATCTCTGGGG - Intergenic
1180485253 22:15789314-15789336 GGACACCATGGAAAGCAATGTGG - Intergenic
1181160748 22:20958105-20958127 GCCCGCCAAGGAAAGCCCTGGGG + Intergenic
1181908725 22:26220760-26220782 AAACCCCATGCTAAGCTCTGGGG - Intronic
955000717 3:54924931-54924953 GAAGCCCATGGAAAGCTCCAGGG + Exonic
956012228 3:64844163-64844185 GCACACCATGGAAGGCCTTGTGG - Intergenic
957367630 3:79246895-79246917 AAACACCATGGTAAACCCTGGGG + Intronic
957946056 3:87064358-87064380 GAGCCCTATGAAAAGTCCTGTGG + Intergenic
961746335 3:129065702-129065724 GATGCCCATGGCTAGCCCTGAGG + Intergenic
962028551 3:131574253-131574275 GAACCCTTTGGAAAGCAATGTGG - Intronic
962986458 3:140540650-140540672 GAAACTCATGGAAAGGACTGGGG - Intronic
964664655 3:159159019-159159041 GAGCCACATGGGAAGCACTGGGG + Intronic
965254222 3:166383235-166383257 GAACACCATGGAAAGGCTTGTGG + Intergenic
965764435 3:172115186-172115208 GAACCCAAAGGAAAGAACTGAGG - Intronic
968706517 4:2080807-2080829 TCAGCCCATGGAAGGCCCTGGGG - Intronic
968797960 4:2721575-2721597 GAGCCCCATGGCAAGACCAGAGG + Intronic
970459299 4:16256844-16256866 GGACCCCATGGAAAGCATTCAGG + Intergenic
970756228 4:19429700-19429722 AAACCTCTTGGAAGGCCCTGGGG + Intergenic
971197245 4:24481214-24481236 TAACTCCTTAGAAAGCCCTGTGG - Intergenic
971364687 4:25968315-25968337 GAAGCACACGGAAAGCTCTGAGG - Intergenic
973710455 4:53624692-53624714 GACCCCCAGGGAAAGGCCTTGGG - Intronic
976055910 4:81066721-81066743 GAACCACCTGGAAAGTGCTGGGG + Intergenic
979226102 4:118286779-118286801 AAACCCCATGAAAATCCATGGGG + Intronic
980541553 4:134201951-134201973 CAGACCCATGCAAAGCCCTGCGG - Intergenic
981748923 4:148074976-148074998 GAACACCAGGGAAGGCCCTGTGG - Intergenic
984698923 4:182806366-182806388 GAACCCCAGGGGAAGGCCAGAGG - Intergenic
985032213 4:185800619-185800641 TAAGCCCATGCACAGCCCTGGGG - Intronic
985669568 5:1200570-1200592 GGACCCCGTGGTCAGCCCTGTGG + Intergenic
991659438 5:68935304-68935326 GAAGCCCACGGAAAGCCCTAAGG + Intergenic
992041342 5:72836276-72836298 GAACACCCTGAAAAACCCTGGGG - Intronic
992145529 5:73843428-73843450 GCAATCCCTGGAAAGCCCTGGGG + Intronic
992197970 5:74358218-74358240 GACCCACATGGAAGACCCTGTGG - Intergenic
995851445 5:116550444-116550466 GAATCCCATGGCAGGCTCTGAGG + Intronic
997465547 5:134085559-134085581 GCAGCCCATGCAAACCCCTGAGG - Intergenic
999837385 5:155389078-155389100 GAACCACCTTGAAAGCCCTGAGG - Intergenic
1000146932 5:158462494-158462516 GAAACCCATTGACAGGCCTGGGG + Intergenic
1000697704 5:164408943-164408965 GAACCTCAAGGAAAGCACTCAGG - Intergenic
1001742394 5:174064854-174064876 GAATCCCAGGGAATGCCCCGAGG + Intronic
1001858037 5:175029695-175029717 GACCAGCATGGTAAGCCCTGGGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003125086 6:3349417-3349439 CAACCCCGAGGCAAGCCCTGTGG + Intronic
1003161935 6:3643612-3643634 CAACCCCATGGAACACCCTGGGG - Intergenic
1003533888 6:6959275-6959297 CAACCCAATGGAAAACTCTGGGG + Intergenic
1007647219 6:43392223-43392245 TCACCCAATGAAAAGCCCTGGGG + Intergenic
1015346378 6:132164239-132164261 GAAACTCAAGGAGAGCCCTGAGG - Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1019010060 6:168837743-168837765 GAAACACCTGAAAAGCCCTGGGG - Intergenic
1019314453 7:377964-377986 GAACCCCACTCACAGCCCTGCGG + Intergenic
1019798823 7:3072776-3072798 GACCTCCATGAAATGCCCTGAGG + Intergenic
1023545850 7:41317193-41317215 CAACCCCACGGAAGCCCCTGTGG + Intergenic
1023938466 7:44755767-44755789 TAACCCCACAGAAGGCCCTGGGG - Intronic
1024619104 7:51142196-51142218 GTACCCCATGGAATGCCTGGGGG + Intronic
1026134569 7:67648011-67648033 GAATCCCATTGAAAGCCCTGAGG - Intergenic
1026681632 7:72471530-72471552 GAACCCCATGGACACCACTTTGG - Intergenic
1028582456 7:92422061-92422083 AAAGCCCATGGAAAGCCCTAAGG + Intergenic
1031079067 7:117240876-117240898 GGACCCCCAGGAAGGCCCTGGGG + Intergenic
1031614315 7:123863429-123863451 GCACACCATGGGAAGCCATGGGG + Intronic
1031841919 7:126752566-126752588 GAAACCCATGGAAATCCTTATGG - Intronic
1034384507 7:150728098-150728120 GAACACCAGGTAAAGCCCTGTGG + Intronic
1036090879 8:5663966-5663988 GAACCCCAGGGAAGTGCCTGAGG - Intergenic
1036227830 8:6974773-6974795 GATTCCCATGCACAGCCCTGGGG + Intergenic
1036230283 8:6993890-6993912 GATTCCCATGCACAGCCCTGGGG + Intergenic
1036232735 8:7012993-7013015 GATTCCCATGCACAGCCCTGGGG + Intronic
1036900376 8:12665450-12665472 GAAGCCACTGGCAAGCCCTGAGG - Intergenic
1038744212 8:30242600-30242622 GAAACCCAGGGAGAGCCCCGTGG + Intergenic
1038845780 8:31228548-31228570 GACCCTCTGGGAAAGCCCTGGGG + Intergenic
1040310914 8:46236425-46236447 GTACGCCCTGGACAGCCCTGGGG - Intergenic
1040334949 8:46411380-46411402 GACCACCAGGGAAAGCCCTGGGG - Intergenic
1040627218 8:49162434-49162456 GAAGCCTGTGGAAAGGCCTGAGG + Intergenic
1040692969 8:49962089-49962111 GAAACAAATGCAAAGCCCTGTGG + Intronic
1043408063 8:79960056-79960078 AAACCCCAAGGAAAGCCCTGTGG - Intronic
1044374222 8:91450403-91450425 CAATCACATGGAAAGCACTGGGG + Intergenic
1044485369 8:92746978-92747000 GAACTCCATGGAAAAATCTGAGG - Intergenic
1046095275 8:109551494-109551516 GAATTTCATGTAAAGCCCTGAGG - Intronic
1046290823 8:112158199-112158221 AAAACACATGGAAAGACCTGAGG + Intergenic
1046502298 8:115094241-115094263 GAACGCCATGGAAAGGCATTTGG + Intergenic
1047927715 8:129697539-129697561 GAACCCCATTGAAAGCAAGGGGG + Intergenic
1049308869 8:141922852-141922874 GAACCGGATGGGAAGCCCTGGGG - Intergenic
1051417026 9:16852829-16852851 AAACCCCATGCAAAGGGCTGAGG + Intronic
1056834647 9:89944665-89944687 GAACCCTCTGCAAAGCCCAGGGG + Intergenic
1057186014 9:93058120-93058142 AAACAGGATGGAAAGCCCTGGGG - Intergenic
1057213981 9:93218221-93218243 GCACCCCAGGGCAAGGCCTGTGG - Intronic
1060600622 9:124875183-124875205 GAACCCCAAGGCAAGCCAGGTGG - Intronic
1061371590 9:130200670-130200692 GAGCCCCCAGGAACGCCCTGTGG - Intronic
1062158259 9:135066026-135066048 GCACCCCATGCAGAGGCCTGAGG - Intergenic
1187697218 X:21934561-21934583 GAAGCCTATAGAATGCCCTGGGG - Intergenic
1187805819 X:23119268-23119290 GAACTCCCGGGGAAGCCCTGGGG - Intergenic
1189466896 X:41284322-41284344 GAAACCCAAGGAAAGCCCTGGGG - Intergenic
1195755970 X:108198975-108198997 GACCTCCATGGAAGGACCTGTGG + Intronic
1195821526 X:108950229-108950251 AAACACCATGGAAAACACTGTGG - Intergenic
1201345626 Y:12981186-12981208 GAAGCAGATGGAAAGCCATGTGG + Intergenic