ID: 1175720448

View in Genome Browser
Species Human (GRCh38)
Location 20:61282846-61282868
Sequence GCATTTGCACGCATGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 3, 2: 6, 3: 17, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175720448 Original CRISPR GCATTTGCACGCATGTGCTG TGG Intronic
905093463 1:35448542-35448564 GAATTCCCACACATGTGCTGGGG + Intronic
914081350 1:144413855-144413877 GCACCTGCACGCAGGAGCTGAGG - Intergenic
914096001 1:144544752-144544774 GCATCTGCACGGAGGAGCTGAGG + Intergenic
914176257 1:145282394-145282416 GCACCTGCACGCAGGAGCTGAGG - Intergenic
914302523 1:146389213-146389235 GCATCTGCACGGAGGAGCTGAGG - Intergenic
914530984 1:148523880-148523902 GCACCTGCACGCAGGAGCTGAGG - Intergenic
1067092152 10:43273025-43273047 GCAATTTCATGCATCTGCTGGGG + Intergenic
1068759484 10:60691867-60691889 GTATATGCATGCATGTGCTTTGG - Intronic
1070663558 10:78327903-78327925 GCATGTGCAGGCATGAGCAGTGG + Intergenic
1074550096 10:114434753-114434775 TCATATGCACGCACGTGTTGGGG + Intronic
1077362175 11:2145597-2145619 GCATTTTCAAGCATGAGCGGTGG - Intronic
1079828784 11:25234533-25234555 GCCTTTGCCCCCATGTCCTGAGG - Intergenic
1083603219 11:63961646-63961668 GCATTTGCACCCATGTGGGACGG - Intergenic
1085445339 11:76597518-76597540 GCATTTGCTGGGATGTGTTGTGG - Intergenic
1086772239 11:90780833-90780855 GCATGTGCACACATGTGATACGG - Intergenic
1092064843 12:5581402-5581424 CCATGTGCACGAATGTGGTGAGG - Intronic
1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG + Intronic
1098026204 12:66204726-66204748 GTATTTGCACACATGTTCTTTGG + Intronic
1104330217 12:127837624-127837646 GCAGTTTCACGCATCTACTGGGG + Intergenic
1107227912 13:38072998-38073020 GCATTTTCATACATGTGTTGAGG + Intergenic
1108239513 13:48447685-48447707 GGATTTGAACCCATGTACTGTGG + Intronic
1110694325 13:78470411-78470433 GCATCTGCAGACATGTGGTGTGG + Intergenic
1113510101 13:110846964-110846986 GCACATGCACGCATGTGGGGAGG + Intergenic
1114552669 14:23542376-23542398 ACATTTGCATGGATTTGCTGAGG + Intronic
1118260191 14:64239163-64239185 CCATCTGCCCTCATGTGCTGGGG - Intronic
1120426779 14:84358615-84358637 GCATTTGCCTGCCTTTGCTGAGG + Intergenic
1120867482 14:89308410-89308432 GCAGATGCACGCACTTGCTGTGG + Intronic
1122188159 14:100017958-100017980 GCATTCGCACGAAGGTGCTCTGG - Intronic
1131525527 15:93149583-93149605 ACATTTGAAAGAATGTGCTGTGG + Intergenic
1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG + Intronic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1147734698 17:42628352-42628374 TCATATGCACACATATGCTGGGG + Intergenic
1149252187 17:54783250-54783272 TCATGTGCACGCATGTGCTCAGG - Intergenic
1150218108 17:63481396-63481418 GCACTTTCACTCATCTGCTGTGG + Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1166743960 19:45131076-45131098 GCATTTGCACACAGGTGCAATGG - Intronic
927668227 2:25046865-25046887 GCACATGCGCACATGTGCTGTGG - Intronic
929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG + Intergenic
932422289 2:71608344-71608366 GCATTTGGACGCATGGTCAGAGG + Intronic
936097921 2:109547926-109547948 CCCTTAGCACACATGTGCTGGGG + Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
945972329 2:216243043-216243065 GCATTTGGAGTGATGTGCTGTGG - Intergenic
947470738 2:230399237-230399259 GTATTTGCATCCATGTGTTGTGG - Intronic
948866347 2:240776755-240776777 GCATCTGCGTGCATGTCCTGGGG - Intronic
1168733105 20:104115-104137 CCATTTGCAGGCATGTTCTATGG - Intergenic
1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG + Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176891122 21:14320784-14320806 GCATTTCTACTCATGTGCTTTGG + Intergenic
1178103770 21:29297793-29297815 GCATTTGCACCCACAGGCTGTGG - Intronic
1179394478 21:41025322-41025344 GAATGTGCATGCATGTGGTGAGG - Intergenic
1182923504 22:34101721-34101743 GCAGTTTCAGGCATCTGCTGAGG - Intergenic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
953038210 3:39231664-39231686 GCATTTGCTGGCATGAGTTGGGG + Intergenic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
957423792 3:80008811-80008833 GCATTTGCTAGCATCTGCAGAGG - Intergenic
976695255 4:87912408-87912430 ACATTTGCAGGCAAATGCTGGGG - Intergenic
985546240 5:510617-510639 GCATTTTCAGGCATTTGCTGAGG + Intronic
985807376 5:2056704-2056726 ACACTGGCACGCATTTGCTGAGG - Intergenic
986828983 5:11554420-11554442 ACATTTGAATGCATGTGCTTGGG + Intronic
988352005 5:30120683-30120705 AAATTTGCACTCATTTGCTGGGG - Intergenic
996252862 5:121358893-121358915 GCATTTGCAGACATGTGCCAAGG - Intergenic
1001350410 5:170957490-170957512 TCATTTGCAGACATGTGCTTAGG + Intronic
1002139649 5:177131479-177131501 GCACTTGCAGACATGTGCTAAGG + Intergenic
1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1016510997 6:144842825-144842847 GCACATGCATGCATGTGCTTTGG - Intronic
1018933635 6:168259068-168259090 GCATCCGCACGCATGAGCTGTGG - Intergenic
1022030426 7:26487469-26487491 GCATTTGAAAGCATGAACTGGGG - Intergenic
1022956671 7:35387073-35387095 TCATTTGCGCCCATGTGCTCAGG - Intergenic
1023824174 7:43997691-43997713 GCATGGGCAGGCAGGTGCTGGGG - Intergenic
1026857142 7:73762394-73762416 GGATTTGCAGGCATGGGCAGAGG - Intergenic
1027000347 7:74648651-74648673 GCATTTGCAGCCAGGTGCGGTGG - Intergenic
1027327924 7:77062742-77062764 GCATGGGCAGGCAGGTGCTGGGG + Intergenic
1028948366 7:96606218-96606240 GCATTTGCAGGCATCCACTGGGG + Intronic
1029752439 7:102551020-102551042 GCATGGGCAGGCAGGTGCTGGGG - Intronic
1029770391 7:102650113-102650135 GCATGGGCAGGCAGGTGCTGGGG - Intronic
1030273240 7:107692465-107692487 GCATTTACAAGTATGTGCTAAGG - Intronic
1031926663 7:127645017-127645039 GCAGTTTCAGGCATCTGCTGGGG + Intergenic
1036288502 8:7465850-7465872 GAAATTGCACACATGTGCAGGGG + Intergenic
1036332973 8:7845678-7845700 GAAATTGCACACATGTGCAGGGG - Intergenic
1036460707 8:8950070-8950092 GGTTTTGCACGCATAGGCTGAGG - Intergenic
1037815942 8:22111942-22111964 GCATATGTGCGCATGTGCGGTGG + Intergenic
1040840772 8:51781974-51781996 TCATTTGAACACATGTGGTGAGG - Intronic
1041195687 8:55399549-55399571 GCATTTCCACACATGTGGTTAGG - Intronic
1042879350 8:73470088-73470110 GCTTTTGCAGGGATGTGGTGAGG + Intronic
1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG + Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1050251267 9:3747381-3747403 GCATTTTCAACCATGTGCAGTGG - Intergenic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1055039814 9:71857314-71857336 GCACTTGCTCTCATTTGCTGTGG + Intergenic
1056693579 9:88827957-88827979 GCATGCGGATGCATGTGCTGAGG + Intergenic
1188371779 X:29378749-29378771 GCATTTGCAGCCATGCTCTGTGG + Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1194388793 X:93290577-93290599 ACTTTTGCACTCATGTGTTGGGG + Intergenic
1199703092 X:150399844-150399866 CCATTTGTATGCATTTGCTGGGG - Intronic