ID: 1175720449

View in Genome Browser
Species Human (GRCh38)
Location 20:61282885-61282907
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 3, 1: 7, 2: 11, 3: 6, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902668839 1:17958018-17958040 GAATTTGCCATCGTGTGCTGGGG + Intergenic
912608639 1:111019440-111019462 GCATTTGCAGTTGTGTACTGTGG - Intergenic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063042029 10:2351725-2351747 TCATTTGCAATCGTGTTCTGAGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1076410815 10:130248517-130248539 AGACTTGCACGTGTGTGCTGTGG - Intergenic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1086853692 11:91841121-91841143 GCATCTGCACATGTGCGCTGGGG - Intergenic
1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG + Intronic
1102464271 12:113119384-113119406 CCATTTGCACGTGTGTTTTGGGG - Exonic
1106031474 13:26009417-26009439 GCATCTGCGCACGTGTGGTGTGG + Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1110967006 13:81712994-81713016 GCATTTGCAGCTGTGTTCTGTGG + Intergenic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1120426779 14:84358615-84358637 GCATTTGCCTGCCTTTGCTGAGG + Intergenic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1130243378 15:82219722-82219744 GCATTTGCTCGGGTGTTCAGTGG - Exonic
1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG + Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1141570324 16:84930095-84930117 GCATTTGCAGCCGTTGGCTGGGG - Intergenic
1141983439 16:87564145-87564167 GCATTTGTGTGCGTGTGTTGGGG + Intergenic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1149252187 17:54783250-54783272 TCATGTGCACGCATGTGCTCAGG - Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1157131205 18:45009018-45009040 GCAATTGCCACCGTGTGCTGTGG + Intronic
1160263900 18:77321983-77322005 GCACGCGCACACGTGTGCTGGGG + Intergenic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
1173221507 20:41136575-41136597 GCATTTGCAGGAGGGCGCTGCGG + Intergenic
1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG + Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG + Intronic
955554924 3:60126677-60126699 GCATTTATGAGCGTGTGCTGTGG - Intronic
965906271 3:173710596-173710618 GACATTGCACTCGTGTGCTGTGG - Intronic
968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG + Exonic
985546240 5:510617-510639 GCATTTTCAGGCATTTGCTGAGG + Intronic
985924443 5:3004850-3004872 GCATTTGCACAGGTGGACTGTGG - Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG + Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1018933635 6:168259068-168259090 GCATCCGCACGCATGAGCTGTGG - Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1023635755 7:42208494-42208516 GCATTTACAGGCGGGAGCTGGGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1038068603 8:23988977-23988999 GCCTTTTGACTCGTGTGCTGTGG - Intergenic
1039201579 8:35099788-35099810 CCATTAGCACCTGTGTGCTGTGG - Intergenic
1047775254 8:128065135-128065157 GCATGTGCATGCGTGTGCAAGGG + Intergenic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic