ID: 1175720456

View in Genome Browser
Species Human (GRCh38)
Location 20:61283154-61283176
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 11, 1: 3, 2: 4, 3: 7, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1075747589 10:124738459-124738481 GAGTTTGTAGGAGCGTGCTGGGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1087969975 11:104468493-104468515 GCGTTTGCAGGTGGGTGGTGAGG + Intergenic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1129106239 15:73309265-73309287 GCCTTTGCACTGGCCTGCTGGGG - Intergenic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG + Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1161106568 19:2446491-2446513 GCCTCTGCACGCGCCAGCTGGGG + Intronic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
934685940 2:96321796-96321818 GCCTGTGCACGCGCCTGCGGAGG - Intergenic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG + Intergenic
980013735 4:127623901-127623923 GCGCATGCGCGCGCGTGTTGGGG - Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1003009512 6:2413629-2413651 GTGTTTGCATGCACGTGCTCAGG - Intergenic
1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG + Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG + Exonic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1029105827 7:98174905-98174927 GCGTTTCCACTCTCCTGCTGGGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic