ID: 1175720463

View in Genome Browser
Species Human (GRCh38)
Location 20:61283418-61283440
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 3, 1: 14, 2: 4, 3: 7, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1076685927 10:132198500-132198522 GAGTTGGCTCGGGTGTGCTGTGG - Intronic
1076759455 10:132594511-132594533 GCGTTTGCATGCCTGTGCACGGG + Intronic
1077135706 11:997268-997290 GCGTGTCCCCGGGTGTGCTGGGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1087969975 11:104468493-104468515 GCGTTTGCAGGTGGGTGGTGAGG + Intergenic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1108484011 13:50906555-50906577 GCGTCTGCATTCGTTTGCTGAGG + Intergenic
1113484286 13:110642900-110642922 GCGCTTGCACACGTGTGTTTCGG + Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1131527097 15:93161168-93161190 CCGTCTTCACGCTTGTGCTGGGG + Intergenic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1142239846 16:88940223-88940245 GCGTCCGCCCGTGTGTGCTGGGG - Exonic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG + Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
936611543 2:114006576-114006598 GTGTTTGCAGAAGTGTGCTGTGG - Intergenic
937265688 2:120613497-120613519 GTGCACGCACGCGTGTGCTGGGG - Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
965906271 3:173710596-173710618 GACATTGCACTCGTGTGCTGTGG - Intronic
968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG + Intergenic
968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG + Exonic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
988800686 5:34693722-34693744 CTGTTAGCAAGCGTGTGCTGCGG - Intronic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
997626480 5:135334609-135334631 CCGTTTGTAAGCGTGTGTTGTGG - Exonic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1026890342 7:73978145-73978167 GCGTTTGCAAGCGTGTGTGCAGG + Intergenic
1032284134 7:130528170-130528192 GCGTTTGTACCCGTGGGATGTGG + Intronic
1034497695 7:151432176-151432198 GCGACTGCACTCGTGCGCTGTGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1037210757 8:16384312-16384334 GGGATTGCAGGCGTGAGCTGTGG - Intronic
1038068603 8:23988977-23988999 GCCTTTTGACTCGTGTGCTGTGG - Intergenic
1047684923 8:127295238-127295260 GTGTTTGCAAGCATGGGCTGCGG + Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic