ID: 1175720468

View in Genome Browser
Species Human (GRCh38)
Location 20:61283531-61283553
Sequence GCATTTACACGCGTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 3, 2: 6, 3: 14, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175720468 Original CRISPR GCATTTACACGCGTGTGCTG TGG Intronic
901810145 1:11762749-11762771 GCATTTACAAGCCCCTGCTGGGG + Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905177039 1:36143235-36143257 GCATTTACGTGTGTGTGTTGGGG + Intronic
919581311 1:199377493-199377515 GCATTTACATGACTGTACTGTGG + Intergenic
1068041188 10:51826230-51826252 GCATTTAGAGTAGTGTGCTGTGG - Intronic
1075075797 10:119349476-119349498 GCAGTTACCCGCCTGTACTGTGG + Intronic
1076169025 10:128304762-128304784 GCATGTACACCAGAGTGCTGGGG - Intergenic
1100185427 12:92133927-92133949 ACATTTACAGGCTTGTGATGAGG + Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1120452590 14:84687773-84687795 ACATTTAAGAGCGTGTGCTGGGG - Intergenic
1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1127622007 15:60743300-60743322 GCATTTACAGCCGGGTGCGGTGG - Intronic
1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG + Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG + Intronic
1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG + Intergenic
1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG + Intronic
1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG + Intronic
1166157334 19:40923703-40923725 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166166193 19:40990728-40990750 GCATTTACATTTGTGTGTTGTGG - Intergenic
1168517587 19:57021314-57021336 GCATTTACACACGTGGGTGGCGG - Intergenic
925013454 2:503680-503702 GCTTTTACACGCGTGTTCCTCGG - Intergenic
925288873 2:2733525-2733547 GCCTGCACACGCGTGTGCGGTGG - Intergenic
929424678 2:41831986-41832008 CCAAATACACTCGTGTGCTGAGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
1170909310 20:20548791-20548813 GTAATTACAGGTGTGTGCTGAGG - Intronic
1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG + Intronic
1175638141 20:60602664-60602686 GCATTTACCCTGGAGTGCTGGGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1177470244 21:21551925-21551947 GCATTTACACTGGTTTACTGAGG - Intergenic
1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG + Intergenic
1182515323 22:30855427-30855449 GCAACCACACGCCTGTGCTGTGG - Intronic
1182965151 22:34514578-34514600 CCATTTACACATGTGTGCTTTGG - Intergenic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
955554924 3:60126677-60126699 GCATTTATGAGCGTGTGCTGTGG - Intronic
985546240 5:510617-510639 GCATTTTCAGGCATTTGCTGAGG + Intronic
992890092 5:81195986-81196008 GCAGTTACACGCGTGAGCCACGG - Intronic
996459035 5:123719987-123720009 GCATTTAAACTAGTATGCTGTGG - Intergenic
998394440 5:141809567-141809589 GTATGCACACGCGTGTGCTCTGG - Intergenic
999894778 5:156019875-156019897 GCATTTAAAGCCCTGTGCTGTGG + Intronic
1002347474 5:178557908-178557930 GCATGGACAGGGGTGTGCTGAGG + Intronic
1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG + Intronic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG + Intergenic
1021873140 7:25023252-25023274 TCACTTACAAGCGTGAGCTGTGG - Intergenic
1023635755 7:42208494-42208516 GCATTTACAGGCGGGAGCTGGGG - Intronic
1030273240 7:107692465-107692487 GCATTTACAAGTATGTGCTAAGG - Intronic
1032929305 7:136647978-136648000 GTATTTACAAGAGTGTGGTGGGG + Intergenic
1034162335 7:149002639-149002661 GCAGTGACACGTGTGTGTTGGGG - Intergenic
1038068603 8:23988977-23988999 GCCTTTTGACTCGTGTGCTGTGG - Intergenic
1062167197 9:135113780-135113802 GCTTCCACACCCGTGTGCTGGGG - Intronic
1196031528 X:111098725-111098747 GCTTTTACATGGGTGGGCTGGGG + Intronic
1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG + Intronic