ID: 1175720470

View in Genome Browser
Species Human (GRCh38)
Location 20:61283568-61283590
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 2, 1: 3, 2: 10, 3: 34, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900285130 1:1895432-1895454 GCCTCAGCAGGTGTGTGCTGAGG - Intergenic
900293911 1:1939210-1939232 GCATATGTGTGTGTGTGCTGGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
901815429 1:11790912-11790934 GCATGTGTGCGTGTGTGCGGGGG - Intronic
904058229 1:27686279-27686301 CCAGTGGCTCGTGTGTGCTGGGG - Intergenic
905177039 1:36143235-36143257 GCATTTACGTGTGTGTGTTGGGG + Intronic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
910838539 1:91539471-91539493 GTATTTGCAGGTGTGGGCTCTGG + Intergenic
912608639 1:111019440-111019462 GCATTTGCAGTTGTGTACTGTGG - Intergenic
915218702 1:154356827-154356849 GAACTTGGACTTGTGTGCTGGGG - Intergenic
920353112 1:205350857-205350879 GCATGTGTGTGTGTGTGCTGAGG + Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1069721456 10:70552204-70552226 GCATTTTGTCGTGTTTGCTGAGG + Intronic
1071986124 10:91052460-91052482 GCATATGCAGGTGTGTACAGAGG + Intergenic
1073254061 10:102139832-102139854 GCATTGGCAGGTGGGTTCTGAGG - Exonic
1076410815 10:130248517-130248539 AGACTTGCACGTGTGTGCTGTGG - Intergenic
1077090099 11:774497-774519 GCTTCTGCACGTGTGTGAGGAGG - Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1082090293 11:48083527-48083549 ACATTTGCACATGTGGGATGTGG - Intronic
1084454091 11:69257413-69257435 TCATATGCAGCTGTGTGCTGGGG - Intergenic
1086555147 11:88101098-88101120 GCCTTTCCAGGTGTGTGTTGGGG - Intergenic
1086853692 11:91841121-91841143 GCATCTGCACATGTGCGCTGGGG - Intergenic
1087969975 11:104468493-104468515 GCGTTTGCAGGTGGGTGGTGAGG + Intergenic
1088860807 11:113797536-113797558 GCAATTGCCGGTGTCTGCTGAGG + Intergenic
1091116710 11:133019923-133019945 GCATGTGCATGTGTGCACTGGGG - Intronic
1093253110 12:16832706-16832728 GCACATGCATGTGTGTGTTGGGG + Intergenic
1093520102 12:20040151-20040173 GCATTTTTCCATGTGTGCTGTGG - Intergenic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1098306156 12:69104890-69104912 GCACTAGCAGGTCTGTGCTGTGG - Intergenic
1099888965 12:88566203-88566225 GCAGTTTCATGTGTCTGCTGAGG + Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1102237871 12:111305916-111305938 GCATGTGTTAGTGTGTGCTGTGG + Intronic
1102464271 12:113119384-113119406 CCATTTGCACGTGTGTTTTGGGG - Exonic
1104226269 12:126837675-126837697 GCATTTGCAATTGTGTTCTCAGG + Intergenic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1107892359 13:44925238-44925260 GCCTTTGCACTTGTGTGGGGAGG + Intergenic
1108492084 13:50991893-50991915 GCACTTGCAGATGTGTGCAGAGG + Intergenic
1108555320 13:51585157-51585179 GGCTTTGCAGGTGTGTGCTTGGG + Intronic
1110967006 13:81712994-81713016 GCATTTGCAGCTGTGTTCTGTGG + Intergenic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1117035813 14:51727404-51727426 GTATTTGCACCTCTGTGCTTTGG + Intronic
1117171110 14:53098212-53098234 GCATTTGCAGTTGTGTTTTGAGG - Intronic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1121598925 14:95188048-95188070 GTATTTGCACGTGTTTTCTCTGG - Exonic
1123040615 14:105488799-105488821 GTACATGCGCGTGTGTGCTGGGG + Intronic
1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1124193987 15:27604477-27604499 GCTTTTGCTAGTGTGGGCTGTGG + Intergenic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1130243378 15:82219722-82219744 GCATTTGCTCGGGTGTTCAGTGG - Exonic
1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG + Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1132507755 16:320552-320574 AAATTTGCACGTGTGTGTTAAGG - Intronic
1135529743 16:23242790-23242812 GCATACGCATGTGTGTGGTGAGG + Intergenic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1138252305 16:55510425-55510447 ACATTTGTCCGTGTGTTCTGCGG + Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1142239846 16:88940223-88940245 GCGTCCGCCCGTGTGTGCTGGGG - Exonic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1142788576 17:2244953-2244975 GCAGTGGCACCTGTGTGCAGGGG + Intronic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1147747670 17:42705244-42705266 GGATGTGCACATGTGTGGTGGGG + Intronic
1148855616 17:50577751-50577773 GCAGGTGCACGTGTCTGGTGTGG + Intronic
1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG + Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1158491636 18:57915590-57915612 GCATATGAACTTGTGTGCTTGGG + Intergenic
1161019519 19:2001665-2001687 GCACCTGCACCTGTGTCCTGTGG - Intronic
1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG + Intergenic
1165159243 19:33806142-33806164 CCTGTTGCATGTGTGTGCTGTGG + Intronic
1166157334 19:40923703-40923725 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166166193 19:40990728-40990750 GCATTTACATTTGTGTGTTGTGG - Intergenic
1166887545 19:45971424-45971446 ACATATTCATGTGTGTGCTGGGG + Intronic
925572160 2:5324284-5324306 GCATCTGCATGTGTGTGGTTGGG - Intergenic
925766760 2:7243872-7243894 ACACCTGCACCTGTGTGCTGGGG - Intergenic
925879340 2:8338946-8338968 GCATTTCCACGTGGTTGCTTTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
934948294 2:98558034-98558056 GAATTTGCATGTGTGTACAGAGG + Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
946335270 2:219031529-219031551 GCAGCTGCCCATGTGTGCTGTGG - Exonic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947047058 2:225999583-225999605 GCTTTTGCTCTTGTGTGCAGTGG - Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
1170909310 20:20548791-20548813 GTAATTACAGGTGTGTGCTGAGG - Intronic
1173221507 20:41136575-41136597 GCATTTGCAGGAGGGCGCTGCGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175928758 20:62483659-62483681 GCATATGCATGTGTGTGCACAGG - Intergenic
1176207954 20:63900629-63900651 GCATATGCAGGTCTGTCCTGAGG - Intronic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1179439321 21:41382097-41382119 GCATTTTCCAGTGAGTGCTGTGG - Intronic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1182965151 22:34514578-34514600 CCATTTACACATGTGTGCTTTGG - Intergenic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
1184821353 22:46911081-46911103 ACATGTGCACGTGTATGGTGTGG + Intronic
1184924652 22:47628761-47628783 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924666 22:47628913-47628935 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
950184771 3:10938270-10938292 GCATTTTCAGATCTGTGCTGGGG - Exonic
951549445 3:23862142-23862164 CCACTTGCAGGTGTGTGATGGGG - Intronic
953553200 3:43921133-43921155 GCATATGCACATTTGTGCGGTGG + Intergenic
953619195 3:44518217-44518239 GCATTTGCAGCTGGGTGCGGTGG - Intergenic
954422135 3:50424374-50424396 GCATCTGCACATGTGCTCTGTGG + Intronic
957309266 3:78498747-78498769 CCACTTGCTCATGTGTGCTGTGG - Intergenic
960561182 3:119085170-119085192 ACATTTGCACCTGTGTTCTATGG - Intronic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
965597102 3:170420155-170420177 ACATTTTCACATGTGTCCTGTGG + Intronic
965941443 3:174187446-174187468 GCATTTTCATGTGTGTGCCAGGG - Intronic
968660635 4:1797417-1797439 CCATCTGCCCGTGTGTGGTGGGG - Intronic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
976654364 4:87472671-87472693 GCAGTTGAGCATGTGTGCTGGGG - Intergenic
978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG + Intronic
979291166 4:118980513-118980535 GCATGTGTGGGTGTGTGCTGGGG - Intronic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
981761694 4:148201972-148201994 GTATTTGTAGGTGTCTGCTGTGG - Intronic
982931113 4:161408189-161408211 GCATTTGAAGTTGTGTTCTGTGG - Intronic
985924443 5:3004850-3004872 GCATTTGCACAGGTGGACTGTGG - Intergenic
986618938 5:9650313-9650335 GCATTTGCCCCTGAATGCTGGGG + Intronic
986631804 5:9781423-9781445 GCTTCTGCCCTTGTGTGCTGGGG + Intergenic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
993993861 5:94695225-94695247 GAATTTGAAAGTGTGTCCTGGGG + Exonic
994025721 5:95080221-95080243 GGATTTGGACATTTGTGCTGTGG + Intronic
996541083 5:124630497-124630519 GCATGTGTGCGTGTGTGCTAGGG + Intergenic
998898041 5:146821178-146821200 GCATGTGCACGTGTTGTCTGTGG - Intronic
1000673719 5:164094189-164094211 GAATTAGAAAGTGTGTGCTGTGG + Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1006391282 6:33760379-33760401 TCATATGCACGTGTGTGCACAGG + Intergenic
1006699292 6:35958713-35958735 GCATTTGTGTGTGTGTGTTGCGG + Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1018788175 6:167124935-167124957 GTATTTGCATGTGTGTGCATGGG - Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1030273240 7:107692465-107692487 GCATTTACAAGTATGTGCTAAGG - Intronic
1030701630 7:112647169-112647191 GAATCTGCACGTCTGGGCTGGGG + Intergenic
1034162335 7:149002639-149002661 GCAGTGACACGTGTGTGTTGGGG - Intergenic
1034210311 7:149357549-149357571 GCATTTTCTGGTGTGAGCTGTGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1037895662 8:22652505-22652527 GCATGTGCGCATGTGTGGTGGGG + Intronic
1038964680 8:32558550-32558572 GCATTTGGACCTGTGTGTTTGGG + Intronic
1039201579 8:35099788-35099810 CCATTAGCACCTGTGTGCTGTGG - Intergenic
1042023966 8:64402905-64402927 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049355996 8:142188360-142188382 CCATGTGCAGGTGTGTGCTACGG - Intergenic
1049934097 9:484104-484126 GCTTCTGCACTTGTGAGCTGAGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1059968527 9:119640323-119640345 GAATTTGAACATGTGTTCTGGGG + Intergenic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1061805437 9:133135213-133135235 GCCTTGGCAGGTGTGTCCTGTGG - Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1185734153 X:2484859-2484881 TCATTTGCTCGTGAGTGCAGAGG - Intronic
1187100790 X:16189227-16189249 GCATTTGTATGTCTGGGCTGGGG + Intergenic
1187231640 X:17429200-17429222 GCATCTGCCTGTGTGTACTGGGG + Intronic
1190642049 X:52489499-52489521 TCATTTGCCCGTGTTTGCTTTGG + Intergenic
1190645624 X:52523367-52523389 TCATTTGCCCGTGTTTGCTTTGG - Intergenic
1191049398 X:56175138-56175160 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1192795668 X:74422386-74422408 ACCTTTGCCCCTGTGTGCTGGGG + Intronic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196852259 X:119948588-119948610 GAACTTGCAGGTGTGTTCTGAGG + Intergenic