ID: 1175724019

View in Genome Browser
Species Human (GRCh38)
Location 20:61304615-61304637
Sequence CTAGAGAAAAGGACAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175724016_1175724019 -3 Left 1175724016 20:61304595-61304617 CCATAACAATATTAAGAGGCCTA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG 0: 1
1: 0
2: 3
3: 55
4: 414
1175724014_1175724019 7 Left 1175724014 20:61304585-61304607 CCTGGCTGTGCCATAACAATATT 0: 1
1: 0
2: 2
3: 10
4: 115
Right 1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG 0: 1
1: 0
2: 3
3: 55
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175724019 Original CRISPR CTAGAGAAAAGGACAGCAGA AGG Intronic
900008574 1:84474-84496 ATACAGAAAAGGAAAGCACAGGG + Intergenic
900034611 1:396595-396617 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900055442 1:626483-626505 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900285090 1:1895234-1895256 CAAGTGAAGACGACAGCAGAGGG - Intergenic
900382845 1:2393469-2393491 GCAGAGAAGAGGACTGCAGAGGG + Intronic
903596161 1:24496597-24496619 CTAGAAGAAAGAACAGCAAAAGG + Intergenic
907528160 1:55066197-55066219 CCAGAGAAAAGAACAGCAACAGG + Intergenic
908119989 1:60977014-60977036 CTAGAGAAAACAACATCTGAAGG + Intronic
908774239 1:67625040-67625062 GTAGAGAAAAGCAAAGAAGACGG + Intergenic
909096504 1:71294844-71294866 AGAGAAAAGAGGACAGCAGAAGG + Intergenic
909102524 1:71367327-71367349 ATGGAGAAAATGACAGCAGCAGG - Intergenic
909394224 1:75151459-75151481 CTGGAGATAAGGCCAGGAGATGG + Intronic
910212455 1:84807318-84807340 CTAGAGATGAGGAGGGCAGAGGG + Intergenic
910541544 1:88363941-88363963 GTAGAGAAAAGGGAAGCACATGG + Intergenic
911369398 1:96978541-96978563 CAAGAGAAAATGACAAGAGAGGG - Intergenic
913118042 1:115714594-115714616 CAAGAGCAAAGGAATGCAGAGGG + Intronic
914448438 1:147770405-147770427 CTAGCTTAGAGGACAGCAGAAGG + Intronic
914449256 1:147776080-147776102 CCAGAGAAAAGGACAGGACGAGG + Intergenic
914823678 1:151125231-151125253 CTTGACAGAAGGACAGCACATGG - Exonic
915008121 1:152659512-152659534 ATAGGGAGCAGGACAGCAGAGGG - Intergenic
915075412 1:153304506-153304528 ATAGAGAAAAGCACAGAACAGGG - Intronic
915185894 1:154104975-154104997 CTAGAGGAGAGGAGAGGAGAGGG + Intronic
915212550 1:154321316-154321338 AAAGAGATAAGGACAACAGAAGG - Intronic
915588149 1:156855872-156855894 ATAGAGAAAAATAAAGCAGAAGG - Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
917080846 1:171255670-171255692 CTAGAGAGGAGGCCAGTAGAGGG - Intronic
918073203 1:181148965-181148987 CTGGACCAAAGAACAGCAGAAGG + Intergenic
918129523 1:181613435-181613457 CTAGAGAAAAGAAAATCATAAGG + Intronic
919001470 1:191837240-191837262 CTAGAGATATGGACTGAAGAAGG - Intergenic
919518822 1:198561639-198561661 CTAGAGAAAAGAAGTTCAGATGG + Intergenic
920280586 1:204840428-204840450 CACGTGAAAAGCACAGCAGAAGG - Intronic
920454220 1:206086017-206086039 ATGGGGAAAAGGACAACAGAGGG - Intronic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
922992053 1:229922660-229922682 CCAAAGAAAAGGACAATAGAAGG + Intergenic
923054695 1:230417254-230417276 GGAGGGAAAATGACAGCAGAAGG - Intronic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
924841321 1:247712360-247712382 GTAGTGTAAAGGATAGCAGATGG + Exonic
1063273777 10:4541315-4541337 CTAGAGACCAGCACTGCAGAGGG - Intergenic
1063303617 10:4876412-4876434 CTAAAGAGAAGGTCAGGAGAGGG - Intergenic
1063597531 10:7450447-7450469 ATTGAGAAAAGGACAGTAAAGGG + Intergenic
1063599772 10:7469868-7469890 CTAGAGACACGGAAAGCTGATGG + Intergenic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1066064275 10:31750738-31750760 CCAGAGAAGAGAAAAGCAGATGG - Intergenic
1066266192 10:33777782-33777804 CCAGAGAAAAGGACAGTGGCAGG - Intergenic
1067973207 10:50993889-50993911 GAAGAGAGAAGGACAGAAGAAGG - Intronic
1068011707 10:51459893-51459915 CTAGATAAAAGGGCAGCATCAGG - Intronic
1068409278 10:56634291-56634313 CTAGACAATGAGACAGCAGATGG - Intergenic
1068503870 10:57874598-57874620 ATAGAGAAAAGGTCAGAAGTTGG - Intergenic
1068756588 10:60661478-60661500 CTAAAGAAAAGGAAACTAGAAGG - Intronic
1070010262 10:72466736-72466758 TTATAGAAAAGGAGACCAGAAGG - Intronic
1070225820 10:74504564-74504586 CTAGAGAAAAGAAAATCATAAGG + Intronic
1070230046 10:74556200-74556222 GTAGTGAAAAGGAGAGCAAATGG - Intronic
1071087076 10:81876216-81876238 CGAGGGAAAAAGACAGCAGGAGG - Intronic
1071777541 10:88806076-88806098 CTACAGAAAATGACAGCCAAGGG + Intronic
1071923791 10:90381752-90381774 CTATAGAAACAGACAGCAGTGGG + Intergenic
1072714244 10:97738710-97738732 CTACAGAGCAGGACGGCAGAAGG - Intronic
1072739050 10:97898703-97898725 CTAGAGACAAGGAGAGCAGCTGG + Intronic
1073379452 10:103066613-103066635 CAAGAGAAAGGGACAGCATGAGG - Intronic
1073540548 10:104313665-104313687 GTTGGGGAAAGGACAGCAGAAGG + Exonic
1074899106 10:117801519-117801541 CCAGAGGAAAGGGCAGCAGGGGG - Intergenic
1075856174 10:125631985-125632007 CAAGAGGATAGGACAGAAGATGG + Intronic
1080975583 11:37335933-37335955 CTAAAGGAAAGGAGAGCTGAAGG - Intergenic
1081662078 11:44894432-44894454 CTAGAGAGAAGGAAAGGAGGCGG - Intronic
1083954752 11:65977177-65977199 TGAGAGAAAGGGGCAGCAGAGGG - Intronic
1084046256 11:66569482-66569504 CTAGAGAGAAGAACGACAGATGG + Intergenic
1085663051 11:78387292-78387314 CTAGAGAAGATGACAGCCCAAGG - Intronic
1086396441 11:86420879-86420901 TTAGAGAAAAGGAGAGGAAAGGG + Intronic
1086416776 11:86596810-86596832 TTACAGAAAAGGAGAGCAGAAGG - Intronic
1088398518 11:109396262-109396284 CTCAAGAAAAGGAAAGCTGAAGG + Intergenic
1088791746 11:113232560-113232582 CAAGAGAAAAGAATAGCAGAGGG - Intronic
1089168694 11:116497899-116497921 TCAGAGAAAAGGACAGCACATGG + Intergenic
1089932049 11:122322681-122322703 CTAGACAAAAGGCCAGAGGAAGG - Intergenic
1091224117 11:133947317-133947339 CCAGGGAAAAGAACAGCTGAGGG + Intronic
1091288750 11:134424792-134424814 TCAGTGAAAAGCACAGCAGAAGG - Intergenic
1091671883 12:2457750-2457772 ATTCAGCAAAGGACAGCAGAAGG - Intronic
1091759673 12:3078317-3078339 CCAGGGAAAAGGACAGCTGCAGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092629909 12:10365952-10365974 CAAAAGAAAAGGACACTAGAAGG + Intergenic
1092935559 12:13360337-13360359 CTATACAAAAGCACAGAAGAGGG - Intergenic
1093011253 12:14109729-14109751 CCAGAGTACAGGACAGAAGATGG + Intergenic
1094177569 12:27557179-27557201 ATACAAAAAAGGCCAGCAGAAGG - Intronic
1094671384 12:32573028-32573050 CCAGAGGAAATGACAACAGATGG - Intronic
1095577382 12:43756489-43756511 CGAGAGAGGATGACAGCAGATGG - Intronic
1095922244 12:47543069-47543091 AGAGAGAAAAGGAGAGAAGAAGG + Intergenic
1096033507 12:48442558-48442580 ATAGAGCAAAGGAGAGCTGATGG + Intergenic
1096340787 12:50797152-50797174 ATAGATAAAAGGAGAGAAGAGGG + Intronic
1097322273 12:58239350-58239372 CTGGAAAAAAAGAGAGCAGAAGG - Intergenic
1097448021 12:59697824-59697846 AGAGATAAAATGACAGCAGATGG + Intronic
1098991210 12:77065967-77065989 CCAGAGGACAGGAAAGCAGATGG + Intergenic
1100730732 12:97465081-97465103 CTAGAGAGAAGGTAAGGAGATGG - Intergenic
1101935975 12:109057608-109057630 GAAGAGAAAAAGACAGGAGATGG + Intronic
1103123048 12:118396718-118396740 CTAGAGAAGTGCACAGCAAAAGG + Intronic
1103379100 12:120480074-120480096 GAAGACAGAAGGACAGCAGAAGG + Intronic
1103614922 12:122145896-122145918 CAAGGGAAAGGGACAGCTGAGGG - Exonic
1104421995 12:128643738-128643760 CTAAAGAAAACGAGAGCAGTTGG - Intronic
1104498571 12:129263754-129263776 GTAGAGGAAAAGAAAGCAGAAGG + Intronic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1105273418 13:18899781-18899803 CTATAGTAAAGGACAGCACTGGG + Intergenic
1105629546 13:22148649-22148671 GGAGAGAAAAGGAGAGGAGAGGG - Intergenic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106081559 13:26504971-26504993 AGAGAGAAAAGGAAAGGAGAAGG + Intergenic
1107025586 13:35798176-35798198 CTAGAGAAATGGAGACCAGGAGG - Intronic
1107407384 13:40127449-40127471 GGAGAGAAAAGGTAAGCAGAGGG - Intergenic
1108581659 13:51833230-51833252 ACAGAGAAAAGGAGATCAGATGG + Intergenic
1108794989 13:54019857-54019879 CTAGGGATCAGGACAGGAGAGGG + Intergenic
1109363166 13:61323326-61323348 TTATAGAGAAAGACAGCAGAAGG + Intergenic
1109442841 13:62397821-62397843 TTAAAGAAAAGGAGTGCAGAAGG + Intergenic
1109879099 13:68447996-68448018 CTAGAGAAAAATACAGCTGCAGG - Intergenic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110678349 13:78277503-78277525 CCAGAGGCAAGGACAGCAGCGGG - Intergenic
1111499787 13:89103123-89103145 AGAGAGAAAAGGACAGTTGACGG + Intergenic
1111575358 13:90146110-90146132 CTAGAGAAAATGATAACAGGTGG + Intergenic
1112105233 13:96232651-96232673 CCAGAGACAAGGACTGGAGAGGG + Intronic
1112543389 13:100339731-100339753 CTGGAGAAAAGGAGAGCGGCTGG - Intronic
1113456648 13:110454273-110454295 TTAGAGAAAAGGAGAGCAGCAGG + Intronic
1113583639 13:111448038-111448060 CTGGAGAATAGCTCAGCAGAAGG + Intergenic
1113747220 13:112753582-112753604 AAAGAGAAAAGAACAGCAAATGG - Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1116505857 14:45680419-45680441 CTGGAGAAAAAGACAGAAAAAGG + Intergenic
1117515731 14:56499449-56499471 CAAGGGAGAAGGACAGGAGAAGG + Intronic
1117798820 14:59422692-59422714 TCAAAGAAAAGGACAGTAGATGG - Intergenic
1117853460 14:60001608-60001630 CTAAAGAAAAGGAAAGAAAAGGG + Intronic
1117925393 14:60773794-60773816 CAACAGCAAAGGACAGCACATGG - Intronic
1119193538 14:72701034-72701056 CATGATAAAAGGAGAGCAGATGG - Intronic
1119713939 14:76844912-76844934 CTGGAGGAAGGGACAGCAAAGGG + Intronic
1120072077 14:80115010-80115032 TTAGAGAATAGGAGAGCAGTGGG - Intergenic
1120121824 14:80689924-80689946 CTTGAGAAAAGGACAATAGAGGG + Intronic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1121745394 14:96285923-96285945 CTCGAGAACACGAGAGCAGAGGG - Exonic
1122022002 14:98845792-98845814 GTCTAGGAAAGGACAGCAGAGGG + Intergenic
1126111195 15:45175643-45175665 CTAGAGTAAAAGACAGGAAAAGG + Intronic
1126811073 15:52404617-52404639 CTACAATAAAGGAAAGCAGAAGG + Intronic
1126849289 15:52787719-52787741 GTAGAGCTAAGGACAGCGGAGGG - Intronic
1127434083 15:58939223-58939245 CCAGAGAACAAGACAGAAGAGGG + Intronic
1128244793 15:66125870-66125892 CCAGAGAGAAGCCCAGCAGAGGG + Intronic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128691909 15:69731038-69731060 CTGGAGCAAAGGCCAGCAGAAGG - Intergenic
1129972483 15:79791011-79791033 CTAGAAACCAGGGCAGCAGATGG - Intergenic
1130829973 15:87589459-87589481 CTGGAGACAAGGACACCAGAGGG + Intergenic
1131269229 15:90936191-90936213 CTCGAGGAAAGGCCAGAAGAAGG - Intronic
1131533055 15:93211164-93211186 CCAGAGAAGAGGCCAGCAGCGGG - Intergenic
1131658416 15:94485741-94485763 CTTGTGAAAAGGACACCAGATGG - Intergenic
1131773686 15:95770096-95770118 CAAAAGAAAATGATAGCAGATGG - Intergenic
1131889846 15:96961258-96961280 CAAGAGGAAATGACAGCAGTGGG - Intergenic
1132282527 15:100632667-100632689 CGAGGTATAAGGACAGCAGAGGG + Intronic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1133088432 16:3384154-3384176 CTAGAGAAAAAGGGAGAAGATGG + Intronic
1134093302 16:11402941-11402963 GGAGAGCACAGGACAGCAGACGG - Intronic
1134408626 16:13984527-13984549 ATAAATCAAAGGACAGCAGAAGG - Intergenic
1135083428 16:19455535-19455557 GTAGAGAAAAAGGCTGCAGAAGG - Intronic
1136349185 16:29695982-29696004 CAAGAGCAAAGGACAACACAGGG + Intronic
1138145530 16:54606225-54606247 TTAAAGAAAATGATAGCAGAAGG + Intergenic
1139059423 16:63230911-63230933 GGAGAGAAAAGAAAAGCAGAAGG - Intergenic
1139809043 16:69597184-69597206 CTAGAGAAGAGGGAAGGAGAGGG + Intronic
1139973014 16:70787791-70787813 CCAGAGAACAGTACAGCAGCGGG + Intronic
1140893003 16:79300951-79300973 AGAAAGCAAAGGACAGCAGAGGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1144490132 17:15701181-15701203 CAAGAGAAGAGCACAGAAGAGGG + Exonic
1144552734 17:16255734-16255756 TTGGAGAAAAGGACTGCAGGAGG - Intronic
1144910831 17:18680778-18680800 CAAGAGAAGAGCACAGAAGAGGG - Exonic
1147635499 17:41961507-41961529 CTAGAGGAAAAGAAAGCAGAGGG - Intronic
1148512894 17:48188153-48188175 CTAGATAAAAAGACAGCTGTGGG - Intronic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1153207964 18:2723946-2723968 CTAGAAAACAGGACAGCAAGTGG - Intronic
1153752665 18:8249204-8249226 TTAGAGAAAAGAGAAGCAGAGGG - Intronic
1154007871 18:10548552-10548574 CTAGAGAAAAATACAGGAAAGGG - Intronic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1154162470 18:11990434-11990456 ATAGAGAAGATGAAAGCAGAAGG + Intronic
1154492266 18:14931520-14931542 CTAGAGCTAAGGTCAGCACAGGG - Intergenic
1155028882 18:21966857-21966879 CTAAGGAATAGGACAGCAGAAGG - Intergenic
1156868970 18:41922244-41922266 CTAGAGAAAATGACATCCGGTGG - Intergenic
1157197438 18:45630947-45630969 CTAGATAAGAGGAGAGCAGGAGG - Intronic
1157803177 18:50637477-50637499 CTAAAGTAAAGGACAGGGGATGG + Intronic
1157839059 18:50937772-50937794 AGAGAGCAAAGGACAGGAGAAGG + Intronic
1158064085 18:53384762-53384784 CTATAGAAAAGTACAGAAAATGG - Intronic
1158840359 18:61379511-61379533 CTAGAGAAAAGGAAAGTCTATGG + Intronic
1158915190 18:62118438-62118460 CTAGAGAGAAGGAAACCACAGGG + Intronic
1159524679 18:69572668-69572690 CTAGGGAAAAGAACAGTAAAAGG + Intronic
1159768298 18:72517430-72517452 CTAGAGAAAATGGCAGTATAAGG + Intergenic
1159910584 18:74141935-74141957 CTAGAAAAAAGCACAGTAGCTGG + Intronic
1160403651 18:78629536-78629558 CTAGAGATGAGGACAGAGGACGG + Intergenic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1160733963 19:653371-653393 CTAGAGCCAAGGACAACACAAGG + Intronic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1161657208 19:5523620-5523642 ATAGATAAAAGGACAGCTGTTGG - Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1162796883 19:13091705-13091727 CGAGAGGAAGGGACAGCAGGCGG + Intronic
1164937202 19:32224052-32224074 CTTTAGAAAAGGGCAGGAGATGG - Intergenic
1165946553 19:39446410-39446432 CTGGAGAAAAGAACAGAAAAGGG + Intronic
1166395157 19:42434224-42434246 CTAGAGAAAAGCTTAGCTGAAGG + Intronic
1167329000 19:48842722-48842744 CAAGAGAAAGGGACTGGAGAAGG - Intronic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
927106235 2:19829841-19829863 GAAGAGTAAATGACAGCAGAGGG + Intergenic
927119873 2:19948567-19948589 AAAGAGAAACAGACAGCAGAAGG + Intronic
929713893 2:44291861-44291883 AGAAAGAGAAGGACAGCAGAGGG - Intronic
930004154 2:46882628-46882650 CTAGAGGAAAGGACGGCAGAGGG + Intergenic
930407465 2:50977649-50977671 CTAGAAAATAGGTCAGTAGAGGG - Intronic
932103428 2:68922048-68922070 CTAGAGGAAAGGAAATCAGGAGG + Intergenic
933263509 2:80155932-80155954 CTAGAGCAATGGATAACAGAAGG - Intronic
934619464 2:95795287-95795309 CAAGAGACTAGAACAGCAGAGGG - Intergenic
934641426 2:96029270-96029292 CAAGAGACTAGAACAGCAGAGGG + Intronic
935612724 2:105042431-105042453 CAAGAGAGAAGAACAGCAGGTGG + Intronic
936079066 2:109419823-109419845 CTAGAAACAACGACATCAGAAGG - Intronic
937502372 2:122493483-122493505 CTGGATAAAAGGACAGCTGTTGG - Intergenic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
938598541 2:132813392-132813414 CTAGAGGAAGGGACTGCAGATGG + Intronic
938642038 2:133291431-133291453 CGGGAGGAAAGGAGAGCAGAGGG + Intronic
938739849 2:134220717-134220739 CTAGAGCAAAGGAAAGAGGAGGG - Intronic
941232302 2:162925723-162925745 CTAGAGAAAAGCAAAGCCCATGG - Intergenic
941377375 2:164748215-164748237 CTAGTGAAAAGAATACCAGATGG + Intronic
942210431 2:173664260-173664282 CTAGAGAACAGGAATGCAGTTGG + Intergenic
942758221 2:179366591-179366613 TTAGAGAAAAAGAGAGCAGAAGG - Intergenic
942972380 2:181971876-181971898 CTTGAGGAAAGGAGAGCAAAGGG - Intronic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
943656976 2:190520406-190520428 ATAGAGAAAAGGACAGACAAAGG - Intronic
944413162 2:199461811-199461833 AGAGAGAAAAGGAGAGAAGATGG - Intronic
944972108 2:205004898-205004920 TGAGAGAGGAGGACAGCAGAGGG - Intronic
945182561 2:207106860-207106882 CTAGAGAAAAGGCCAAGAAAGGG - Intronic
945428472 2:209736782-209736804 ATATACAAACGGACAGCAGAAGG + Intergenic
945961033 2:216135280-216135302 CTAGAGAAAAGGTTAGAAGCTGG + Intronic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
947133376 2:226952886-226952908 CCAAAGAGAAGGGCAGCAGATGG + Intronic
947260099 2:228211149-228211171 ATAGAGAACAGGACAGCAAATGG - Intergenic
947357543 2:229312536-229312558 ATGGAGAAGAGGACAGCAGGAGG - Intergenic
948086332 2:235252433-235252455 CAAGGGAAAGGGACAGGAGAAGG + Intergenic
948313892 2:237012184-237012206 CAAGAGAAAAGGTCAGAAGCCGG + Intergenic
948443166 2:238010872-238010894 GAAGATAAAAGGACTGCAGATGG - Intronic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1169530889 20:6483759-6483781 CTTGATAAAAGGGCAGCAGTTGG + Intergenic
1169669586 20:8081548-8081570 ATAGAGAAAAGGTCAGCCCAAGG - Intergenic
1170276291 20:14594158-14594180 GTAGAGGAAAAGTCAGCAGAAGG - Intronic
1171849057 20:30295265-30295287 CTAGAGGAAGAGACAGCAGTAGG + Intergenic
1172830478 20:37829804-37829826 TTATAGAAAATGACAGCAAATGG - Intronic
1173668761 20:44782713-44782735 ATAGAGAAAAGTGCAGCAGCTGG - Intronic
1175023722 20:55878905-55878927 CTAGAAAAAAGGACATTAGTAGG + Intergenic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175727292 20:61327861-61327883 CCACAGAACAGGACACCAGACGG + Intronic
1176809363 21:13521040-13521062 CTATAGTAAAGGACAGCACTGGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1177654587 21:24001444-24001466 CTAGAGAAAAAGACTGTATATGG - Intergenic
1178688063 21:34727007-34727029 CTACAGGAAAGGTGAGCAGATGG + Intergenic
1179144768 21:38758170-38758192 CAGGAGGAAAGGACAGCAGAGGG - Intergenic
1179144878 21:38759219-38759241 CAGGAGGAAAGGACAGCAGAGGG - Intergenic
1180126034 21:45790842-45790864 AGAGGGAGAAGGACAGCAGAGGG + Intronic
1180144999 21:45913928-45913950 CTAGGAAAAGGGACAGGAGAGGG - Intronic
1180153705 21:45966765-45966787 TTAGAGTGAAGGACAGGAGAAGG - Intergenic
1181321090 22:22006888-22006910 CTAGAGAAAAGGAGAGGGAATGG + Intergenic
1183092055 22:35529138-35529160 GCAGAGGAAAGGGCAGCAGAGGG - Intergenic
1183206921 22:36426090-36426112 CAAGAGAAAAGGAAACAAGAGGG - Intergenic
1184852673 22:47129615-47129637 CTAGAGGAAGGCTCAGCAGAGGG + Intronic
949402005 3:3674805-3674827 CTAGAGTACAGGAAAGCAAAAGG + Intergenic
949424815 3:3905592-3905614 CAAGGAAAAAGGACTGCAGAAGG - Intronic
950617367 3:14171871-14171893 CTAGAGAAAAGGAGAAGAGATGG + Intronic
951126106 3:18985435-18985457 CCAGAGAAAAGTAAGGCAGAGGG + Intergenic
951398235 3:22197825-22197847 CTAGAGGAAAGGAAACCAAAAGG - Intronic
951494377 3:23309933-23309955 GAAGAGAAAAGGAAAGGAGAAGG + Intronic
951527048 3:23663523-23663545 CTATAGATAAGGATAGCAAAGGG - Intergenic
952344324 3:32469769-32469791 CTGGGGCAAACGACAGCAGAGGG + Intronic
952428435 3:33199182-33199204 CTAGAAAAAAAGACATCTGAAGG - Intronic
953244645 3:41179431-41179453 CTAGCAAAAAGGAGAACAGATGG + Intergenic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953715040 3:45310264-45310286 CTAGACAAAAGTACAACTGAGGG - Intergenic
953928150 3:46992720-46992742 CTAGGGAACAGGACAGAAGGTGG + Intronic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
956962194 3:74416027-74416049 TTAGAGAAAAGGAATGGAGATGG - Intronic
957580397 3:82065129-82065151 TTAGAGGAAAAGACAGCAGTAGG + Intergenic
957881289 3:86216505-86216527 AAAGAGAAAAGGAGAGGAGAAGG + Intergenic
959320607 3:104869873-104869895 GGAGAGAAAAGGAAAACAGAGGG - Intergenic
960461326 3:117939353-117939375 TTAGACATAGGGACAGCAGATGG - Intergenic
960603155 3:119478136-119478158 CTAGAGACAAGGAAAGCATTTGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961327044 3:126114990-126115012 GTAGAGGAAAGGACAGCAGATGG - Intronic
963392724 3:144688642-144688664 CTTAGGAAAATGACAGCAGATGG + Intergenic
963656239 3:148054929-148054951 CCCAAGAAGAGGACAGCAGATGG - Intergenic
964210876 3:154226698-154226720 CTAGAGAAAGGCAGAGCTGAAGG - Intronic
964439247 3:156688820-156688842 CTTGAGACAGGCACAGCAGATGG - Intronic
964615141 3:158655833-158655855 CTAGACAGAAGGACCACAGAAGG + Intronic
965207769 3:165743920-165743942 CTAGAGTACAGAACAGAAGAGGG + Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966587029 3:181637588-181637610 CAAGAGAAATGTAAAGCAGATGG + Intergenic
966882266 3:184357267-184357289 CTAAAGGGAAGAACAGCAGAGGG + Intronic
967494618 3:190128906-190128928 CTAAAGAAGAGAACAGAAGAGGG - Intergenic
970166064 4:13239845-13239867 CTAGAATATAGGACACCAGAGGG - Intergenic
970200432 4:13599452-13599474 CCAGAGACAGGGACAGCAGGGGG - Exonic
970450936 4:16166033-16166055 CCAGGGAAAAGGACTGGAGAGGG - Intronic
970830175 4:20329014-20329036 CTGGAGAATAGGACAGAATATGG + Intronic
972197929 4:36676448-36676470 CCAGAGAAAAGGACAGTAAAAGG - Intergenic
973288778 4:48449066-48449088 GTAAGGAAAAGGACAGCAGAGGG - Intergenic
973792456 4:54391034-54391056 GGAGAGATAAGGACAGCAGATGG + Intergenic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
973862838 4:55082898-55082920 CTAAAGACAACAACAGCAGATGG + Intronic
975116015 4:70681918-70681940 CTAGATGAAATGAAAGCAGATGG + Intronic
975406705 4:73998690-73998712 GTAGATAAAAGGAGTGCAGAAGG - Exonic
975795232 4:78000040-78000062 CTAGAGAAAAGAAAATCATAAGG + Intergenic
976139752 4:81978988-81979010 TCAGAGATAAGGACAGCTGAAGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978070643 4:104463922-104463944 CTAGATAAATGGAGAGCACATGG + Intergenic
978243320 4:106542176-106542198 CCAGACAAAAGGACAATAGATGG + Intergenic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
979314211 4:119241355-119241377 CAATAGAAAAGGATATCAGATGG - Intronic
979327002 4:119391592-119391614 CTAGTGGAAAGGACAGAAGCTGG - Intergenic
979826183 4:125235368-125235390 GTAAAGAAAAGTACAGCAAATGG + Intergenic
980166815 4:129239183-129239205 ACAGAGCAAAGGAAAGCAGATGG - Intergenic
980768565 4:137341015-137341037 GTACAGAAAAGTAGAGCAGAAGG - Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982331857 4:154189849-154189871 CTGCAGAAAAGGACAGTAGTAGG - Intergenic
983115537 4:163811544-163811566 ATAGAGAAACGGAGAGCAGGAGG + Intronic
983244873 4:165276282-165276304 CTAGTGGAAAGGACAGAAGCTGG - Intronic
983339367 4:166438613-166438635 CTAGAGGAGAGGAAAGAAGAAGG - Intergenic
984270119 4:177539347-177539369 CAAAAGAAAAGGACAGAGGAAGG - Intergenic
984466547 4:180106825-180106847 TCAGAGAAGAGGACTGCAGAAGG + Intergenic
985382898 4:189414057-189414079 CCTGTGAAAAGGACAGCAGGAGG - Intergenic
985863306 5:2491598-2491620 ATACAGATAAAGACAGCAGATGG - Intergenic
986050151 5:4082683-4082705 GTAGAGAAAATGACAGCATGTGG - Intergenic
986347711 5:6850175-6850197 CTAGAGCAAAGGACAGATGATGG + Intergenic
986419339 5:7562763-7562785 ATAAAGAAAAGGACAGCATTTGG - Intronic
987078746 5:14407374-14407396 TTAGAGAAATGGTCACCAGAAGG + Intronic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
990642795 5:57806709-57806731 CTGGAGAAAAGAAAGGCAGAAGG + Intergenic
990925669 5:61019380-61019402 ATAGGGAAAAGGAGAGAAGAGGG - Intronic
991013132 5:61904476-61904498 CAAGAGAGAAGAGCAGCAGATGG + Intergenic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
993013911 5:82514026-82514048 TTAGAGAAATGTACAGCCGAAGG - Intergenic
993044962 5:82856608-82856630 CAAGAGAAAAGGCCAGAAAAAGG - Intergenic
993927682 5:93890997-93891019 ATAGAGAAAAGGAAATGAGAAGG - Intronic
994139835 5:96330033-96330055 CTGGAGAAAAAGACAAGAGATGG - Intergenic
994744114 5:103657611-103657633 AGAGATAAAAGGACAACAGAAGG - Intergenic
995447594 5:112262968-112262990 CTAGAGCAATGGTCAGCAGGAGG + Intronic
996150679 5:120030627-120030649 ATACAGAAAATGACAGCAAATGG - Intergenic
996296677 5:121926483-121926505 CTAAAGAAAAGGCCATCAAAGGG - Intergenic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
997106516 5:131026142-131026164 CTAGAGAAAAGAAAATCATAAGG - Intergenic
997669828 5:135661608-135661630 CTTGAGAAAAGGACCGGGGAGGG - Intergenic
998211896 5:140205928-140205950 CTTGAGAATAAGACAGCAGAGGG - Intronic
998330304 5:141320368-141320390 CTAGGGAACAGGAAAGCAAATGG + Exonic
998365715 5:141629469-141629491 CTAGAGGCAGGGACAGGAGAGGG + Intronic
998459142 5:142296494-142296516 ATAGAGAAACGGAGGGCAGACGG - Intergenic
998997571 5:147882329-147882351 TTAGAGATAAGGAAAGGAGAAGG - Intronic
999944746 5:156582709-156582731 CTAGGGATAAGGAAATCAGAAGG - Intronic
1000309409 5:160027602-160027624 CTGGAGGAAATGACAGTAGATGG - Intronic
1001683372 5:173575256-173575278 CTAGTGCAAGGGACAGGAGAGGG + Intergenic
1001924987 5:175629623-175629645 CAAGAGAGAAGGACAGAAGATGG + Intergenic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002739208 5:181422273-181422295 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1004337064 6:14773701-14773723 CTAGAGAACAGGTCTGCTGATGG - Intergenic
1004343625 6:14828762-14828784 CAAGAGCCAAGGACAGGAGAGGG + Intergenic
1004366543 6:15017952-15017974 CTAGCAGAAAGGCCAGCAGATGG + Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1005069306 6:21849843-21849865 CTAGAGAAAAGAAAATCATAAGG - Intergenic
1005226769 6:23652363-23652385 CTAGAGAAAAGAAAACCAGATGG + Intergenic
1005681913 6:28216664-28216686 CCAGAGAGAAGTACTGCAGAAGG - Intergenic
1005775625 6:29128782-29128804 GAAGAGAAAAGGATAGCAAAAGG + Intergenic
1006089963 6:31622602-31622624 CTGGAGGAAAAGACACCAGAGGG + Intronic
1006744240 6:36330325-36330347 CCAGAGAAAAGGCCAGCAGGAGG - Exonic
1007103463 6:39267507-39267529 CTAGAGAAATGGTAAGAAGAGGG - Intergenic
1007511817 6:42379980-42380002 CTAGAGAAAAGGAATACAGGAGG + Intronic
1007955295 6:45912492-45912514 CAAGAGAAAAGGAAAGAAGGAGG + Intronic
1007975707 6:46099081-46099103 TTAGAGAAAGGGACAGAAAATGG + Intergenic
1009369985 6:62887441-62887463 CTTGAGAAAGAGACAGCTGATGG + Intergenic
1010392913 6:75357318-75357340 CTGGAGAAAAAAACAGCACATGG + Intronic
1010933048 6:81826664-81826686 CAAGATAAAAAGAAAGCAGAAGG + Intergenic
1011106677 6:83789320-83789342 CTAGAGAGAAGGAATACAGATGG + Intergenic
1011490092 6:87882792-87882814 TTAGAAAAAAGAACACCAGATGG - Intergenic
1011505435 6:88037081-88037103 CTAGGGAAAAAGCCACCAGAAGG + Intergenic
1011813570 6:91161403-91161425 TTAGAGAAAAAGACAGATGACGG - Intergenic
1014813262 6:125908196-125908218 CTAGAGAAAATGGCACCAGCAGG + Intronic
1015356431 6:132282365-132282387 CTTGAGAAAAGGACATCTGCTGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016179867 6:141132304-141132326 CCAGAGAAAAGGAAATCATATGG - Intergenic
1017293428 6:152767587-152767609 GTAGAGAACAGAACAGCAAAGGG - Intergenic
1018316350 6:162560618-162560640 TTAATGAAAAGGACACCAGAAGG - Intronic
1018409631 6:163530924-163530946 ATAAAGAAAAAGAAAGCAGAGGG - Intronic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1019244318 6:170697832-170697854 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1021644671 7:22777303-22777325 CTAGAGAAATTAACAGAAGATGG + Intergenic
1022868731 7:34452029-34452051 CCAGAGAAAAGGACAGGAGCAGG + Intergenic
1023712113 7:43006124-43006146 GGAAAGAAAAGGACAGCTGATGG - Intergenic
1024288342 7:47780218-47780240 ATCTATAAAAGGACAGCAGAAGG - Intronic
1024438243 7:49384152-49384174 TTAAAGAAAATGAAAGCAGAAGG - Intergenic
1026183828 7:68065524-68065546 CAAGAGAAGAGGAAAGAAGAAGG + Intergenic
1027489770 7:78808645-78808667 GTAGAAAAAAGCACAGCACAAGG + Intronic
1027520291 7:79198342-79198364 CTATCAAAAAGGACAGGAGAGGG - Intronic
1027882291 7:83855957-83855979 CTTGAGAACAGGAGAGAAGAGGG + Intergenic
1028238247 7:88386582-88386604 CTAGAGTACAGTACAGCAAATGG - Intergenic
1028270971 7:88788548-88788570 ATAGAGAAAATGACTTCAGATGG - Intronic
1029029762 7:97455216-97455238 CTAGAGGAAAGTAAAACAGAAGG - Intergenic
1031060060 7:117040982-117041004 CCAGAGAAAAGGAAAGCAAAGGG - Intronic
1031374396 7:121006508-121006530 CTAAGGAAGAGGAAAGCAGAGGG + Intronic
1031748064 7:125530486-125530508 GGAGAGAAGAGGACAGAAGAAGG + Intergenic
1031869240 7:127074380-127074402 CAAAGGACAAGGACAGCAGAGGG + Intronic
1032023691 7:128424554-128424576 CTAGAAGAAAGGACAGCTGAAGG - Intergenic
1032400497 7:131620909-131620931 CTAAAGAAAAGGAGAGCTGCAGG + Intergenic
1035407685 7:158610227-158610249 ATAGAAAAAAAGGCAGCAGAAGG + Intergenic
1035503807 8:110340-110362 CTAGAGAAAAGGACAGTGAATGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1036486104 8:9180306-9180328 CTACAGACAGGGCCAGCAGAGGG + Intergenic
1036913174 8:12776369-12776391 GTAGAGAAAAGGAAAGGAGAGGG + Intergenic
1036947292 8:13106156-13106178 CCAGATAAAAGCACAGCAGGTGG + Intronic
1037193832 8:16162326-16162348 ATAGAGAAAATGAAATCAGAAGG + Intronic
1037698685 8:21251660-21251682 TGAGAGAAAAGGACAGCCAATGG + Intergenic
1038913855 8:31997691-31997713 TTAGAGCAAAGCACAGTAGAAGG - Intronic
1039459433 8:37731101-37731123 ATAGAGAAAAGAAGAGCAGTAGG + Intergenic
1039544893 8:38402659-38402681 CTAGGGAAGAGGACCCCAGAGGG - Intronic
1041650627 8:60298891-60298913 GGAGACAAAAGGACAGGAGAAGG - Intergenic
1041924500 8:63222399-63222421 TTACACAAAAGGACAGCAGAGGG + Intergenic
1042215787 8:66428944-66428966 CCAGAGGAAAGGCCGGCAGAGGG - Intergenic
1043523401 8:81071281-81071303 CAAGAGAAAAGTGCAGTAGAAGG + Intronic
1044040811 8:87366438-87366460 CGAGAGAGAGGGTCAGCAGAAGG - Intronic
1044345920 8:91104264-91104286 GGAGAGGAAAGGACAGCTGAAGG - Intronic
1046334816 8:112771768-112771790 GTAGAGAAGAGTACAGAAGAGGG + Intronic
1047898906 8:129397941-129397963 CTGGGGAAGAGGACACCAGATGG - Intergenic
1048182841 8:132212351-132212373 GGAGAGAAAAGGACAGTTGAGGG - Intronic
1048223667 8:132565373-132565395 CTCAAGAAAAGGAAATCAGAAGG + Intergenic
1048511720 8:135068951-135068973 ATAGAAAGATGGACAGCAGAAGG - Intergenic
1049134257 8:140880476-140880498 CTCGTGTAAAGGACAGCAAATGG - Intronic
1049560399 8:143307338-143307360 GCAGAGGAAAGGGCAGCAGAGGG + Intronic
1049560409 8:143307385-143307407 GCAGAGAAGAGGGCAGCAGAGGG + Intronic
1049560598 8:143308131-143308153 GCAGAGAAGAGGGCAGCAGAGGG + Intronic
1049560612 8:143308195-143308217 GCAGAGAAGAGGGCAGCAGAGGG + Intronic
1049560642 8:143308318-143308340 GCAGAGAAGAGGGCAGCAGAGGG + Intronic
1050860134 9:10418510-10418532 ATGGAGAAAATTACAGCAGAAGG - Intronic
1050902020 9:10961277-10961299 CTAGGGCAAAGTTCAGCAGAAGG + Intergenic
1051682774 9:19624752-19624774 CTACATAAAAGGAAAGTAGAGGG - Intronic
1052251899 9:26408457-26408479 CTTGAGACAAGGAGAACAGATGG - Intergenic
1052447173 9:28577949-28577971 CTAGAGAAAGTGACAGCATATGG + Intronic
1053023416 9:34710944-34710966 ATATAGAAAAGGAAAGCAAAGGG - Intergenic
1055048119 9:71952108-71952130 CAAGACAAAAGTAAAGCAGATGG + Intronic
1055806909 9:80105939-80105961 CTCAAGAAAAGGACAGTAGAAGG + Intergenic
1058501344 9:105621257-105621279 GCAGAGAAAAGAACAGGAGATGG + Intronic
1058539791 9:105999757-105999779 CTAGGAAACAGGTCAGCAGAGGG + Intergenic
1061370320 9:130194079-130194101 CTAGAGGCATGGACGGCAGACGG - Intronic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1203604506 Un_KI270748v1:47058-47080 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1186822800 X:13308528-13308550 CTAGAGAAAAGAAAATCATAAGG + Intergenic
1187662419 X:21564169-21564191 CATGAGGAAAGGACAGTAGATGG + Intronic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188439553 X:30202030-30202052 CTAGAGGATAGGACAACAAAGGG - Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189727875 X:43986688-43986710 ATAGAGAAATGGACAGCACCTGG + Intergenic
1190393702 X:49958090-49958112 CTATATAAAGGGACAGCAAAAGG - Intronic
1190503244 X:51099716-51099738 CCAGAGACAAGGCCAGGAGAGGG + Intergenic
1192338297 X:70240000-70240022 CCAAAGAAGAGGGCAGCAGAGGG + Intronic
1192589123 X:72345299-72345321 CTAGAAAAAAGCAGAGGAGATGG + Intronic
1193505398 X:82336486-82336508 TCAGAGGAAAGCACAGCAGATGG - Intergenic
1195491525 X:105475938-105475960 CTAGAGAAAAGGGCAACTCAGGG + Intronic
1196097798 X:111818154-111818176 CTGGATAAAAGGACAGCAACTGG + Intronic
1196190189 X:112786238-112786260 GTAAAGAAAAGGGAAGCAGAAGG - Intronic
1197835954 X:130693943-130693965 TTAGAGCAAATGACAGAAGATGG + Intronic
1197836749 X:130702719-130702741 CTAGAGGAGAGGAAAGGAGACGG - Intronic
1198216780 X:134562795-134562817 GAGGAGATAAGGACAGCAGATGG - Intergenic
1199258392 X:145743690-145743712 TGAGAGAAAAGGTCAGAAGAAGG + Intergenic
1199599763 X:149534982-149535004 GAAGAAAGAAGGACAGCAGATGG - Intergenic
1200054842 X:153454842-153454864 CAAGAAAAATGGACAGGAGAGGG + Intronic
1201511596 Y:14770096-14770118 CTAGGGAAAGGGACAGCAGTGGG + Intronic
1202243724 Y:22795021-22795043 CTAGACAGGAGGCCAGCAGAAGG - Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202396711 Y:24428771-24428793 CTAGACAGGAGGCCAGCAGAAGG - Intergenic
1202474072 Y:25241321-25241343 CTAGACAGGAGGCCAGCAGAAGG + Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic