ID: 1175724813

View in Genome Browser
Species Human (GRCh38)
Location 20:61310587-61310609
Sequence CAGGCTGGACAGCAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 0, 2: 6, 3: 80, 4: 738}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175724813_1175724824 6 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724824 20:61310616-61310638 AACAGGCCATGCACTGCCATGGG 0: 1
1: 1
2: 2
3: 25
4: 268
1175724813_1175724827 20 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724827 20:61310630-61310652 TGCCATGGGTCTGCAGCCCCGGG 0: 1
1: 0
2: 2
3: 38
4: 299
1175724813_1175724823 5 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724823 20:61310615-61310637 TAACAGGCCATGCACTGCCATGG 0: 1
1: 0
2: 4
3: 18
4: 134
1175724813_1175724826 19 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724826 20:61310629-61310651 CTGCCATGGGTCTGCAGCCCCGG 0: 1
1: 0
2: 6
3: 49
4: 445
1175724813_1175724831 26 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724831 20:61310636-61310658 GGGTCTGCAGCCCCGGGGTTGGG 0: 1
1: 2
2: 26
3: 101
4: 486
1175724813_1175724830 25 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724830 20:61310635-61310657 TGGGTCTGCAGCCCCGGGGTTGG 0: 1
1: 0
2: 9
3: 84
4: 421
1175724813_1175724828 21 Left 1175724813 20:61310587-61310609 CCCCCTTCCTGCTGTCCAGCCTG 0: 1
1: 0
2: 6
3: 80
4: 738
Right 1175724828 20:61310631-61310653 GCCATGGGTCTGCAGCCCCGGGG 0: 1
1: 1
2: 1
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175724813 Original CRISPR CAGGCTGGACAGCAGGAAGG GGG (reversed) Intronic
900344085 1:2202958-2202980 CAGGATGGACCCCAGGGAGGAGG - Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
900370056 1:2328295-2328317 CAGGCCAGGCTGCAGGAAGGGGG - Intronic
900430908 1:2602843-2602865 CAGCCAGGACAGCAGACAGGAGG - Intronic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
900905645 1:5555259-5555281 CAAGCTGGAGAACAGGAAAGCGG + Intergenic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
901878155 1:12178869-12178891 CAGGCTTGATTGTAGGAAGGGGG + Intronic
901913826 1:12482046-12482068 GACCCTGAACAGCAGGAAGGCGG - Intronic
901915961 1:12500495-12500517 CAGGCTGGTGAGCAGTAGGGTGG + Intronic
902038962 1:13478829-13478851 GGGGCAGGACAGAAGGAAGGAGG - Intronic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902546497 1:17193742-17193764 CAGGCTGGAGAGCAGGGGGTGGG + Intergenic
903182683 1:21612971-21612993 CAGGGTGCACAGCAGATAGGAGG - Intronic
903341695 1:22658871-22658893 ATGGATGGACAGCAGGATGGAGG + Intronic
903457478 1:23497710-23497732 AAGGCTGCACAGCAGGCAGAAGG - Intergenic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
905140758 1:35842208-35842230 CAGGCTGCACAGCAGGTGAGTGG + Intronic
905455169 1:38083654-38083676 CAGCCTGCACAGCAGGGCGGGGG - Intergenic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
905655467 1:39683827-39683849 CAGGCTGGGGAGCAGCAGGGAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906318393 1:44802459-44802481 CAGACAGGAGTGCAGGAAGGGGG + Intronic
906478661 1:46186336-46186358 CAGCCTGGACCCTAGGAAGGGGG - Intergenic
906952578 1:50346895-50346917 GAGGCAGCACAGCCGGAAGGCGG + Intergenic
907237699 1:53062967-53062989 CAGCCGGGACAGCTGGAGGGAGG + Intronic
907629363 1:56064396-56064418 CATTCTGAACAGCAGGGAGGAGG + Intergenic
908119810 1:60975537-60975559 GTGGCTGGAAAGCAGAAAGGGGG - Intronic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
909086446 1:71174277-71174299 CAGGGTGGGGAGCTGGAAGGAGG + Intergenic
911133847 1:94418531-94418553 CAGGCAGAGCAGCAGGAACGCGG - Exonic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912471975 1:109912318-109912340 GAGGCTGGACAGCTGGACTGAGG + Intronic
912953413 1:114136011-114136033 CCGGCTGGCCAGCAGGCAGACGG - Intronic
913077215 1:115350958-115350980 CAGGCTGGACATGAGGCGGGAGG + Intergenic
913326429 1:117632300-117632322 CAGGCTGGAGAGGAGGGCGGGGG + Intergenic
914044647 1:144080537-144080559 AAGGCAGGACAGCCCGAAGGAGG - Intergenic
914133463 1:144880149-144880171 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
915462266 1:156077120-156077142 CAGGCTGTTCTGCCGGAAGGTGG + Exonic
915472501 1:156134474-156134496 CAGGCTGCAGACCATGAAGGAGG + Exonic
915943850 1:160135908-160135930 AATGATGAACAGCAGGAAGGGGG - Exonic
916052967 1:161048998-161049020 CAGGCTAGACATCAGGGAAGAGG - Exonic
916997535 1:170316484-170316506 GAGGCTGGACAGCAAGATTGCGG - Intergenic
917218882 1:172706394-172706416 CAGGATGGAAAGCATGGAGGTGG - Intergenic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
918703740 1:187636756-187636778 CAGTCTGAACAGCAGAAAGAGGG + Intergenic
920373305 1:205493040-205493062 CAGTCTGGACAGGCGTAAGGTGG - Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
922193699 1:223341481-223341503 CAGCCTTCACAGCTGGAAGGTGG - Intronic
922729494 1:227942341-227942363 CTGGGTGCAGAGCAGGAAGGAGG + Intronic
922914975 1:229249841-229249863 CAGGCAGGCAGGCAGGAAGGAGG - Exonic
923013420 1:230107008-230107030 GGGGCTGGACAGAAGGAAGCTGG + Intronic
923186006 1:231574277-231574299 CAGCCTGGGCAACAGAAAGGAGG - Intronic
923275139 1:232388954-232388976 AAGGCTGGCCAGCTGAAAGGAGG + Intergenic
923468513 1:234269467-234269489 CACACTGGGCTGCAGGAAGGAGG - Intronic
923740998 1:236654931-236654953 AAGGCAGGAAGGCAGGAAGGCGG - Intergenic
924272581 1:242349118-242349140 AAGGCAGGACAGCTGGAAGTGGG + Intronic
924561971 1:245164651-245164673 CAGGCTGGAAAGGAGGCAGATGG + Intronic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
924853644 1:247855528-247855550 CAAGCTGGCCAGCGGGAAGGGGG - Intergenic
1062824487 10:557831-557853 CAGGCAGGCAGGCAGGAAGGGGG + Intronic
1063244021 10:4199946-4199968 CAGGCTGGAGAGAAGGCATGGGG - Intergenic
1064119922 10:12609720-12609742 CAGGCTGCACAGCAAGAGGGGGG - Intronic
1065847891 10:29761284-29761306 AGGGCTGGACAGGAGGAAGTAGG + Intergenic
1067016006 10:42756623-42756645 CAGGATGGGGTGCAGGAAGGGGG + Intergenic
1067035535 10:42913400-42913422 TGGCCTGGGCAGCAGGAAGGGGG + Intergenic
1067147003 10:43701349-43701371 GAGGCTGGAAGGCAGCAAGGAGG + Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1067582150 10:47452648-47452670 CAGGCTGGGAAGCTGGAGGGAGG - Intergenic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1068174984 10:53446660-53446682 CAGGCTGGACTGAATGAAGGAGG + Intergenic
1068962407 10:62879050-62879072 CAGGCTGGAGCCCTGGAAGGTGG + Intronic
1069710908 10:70488148-70488170 CAGCCTGGGCAACAGGAAAGAGG - Intronic
1069925998 10:71851192-71851214 GAGGCTGGCCAGGAGGAAGAGGG + Exonic
1070809567 10:79290837-79290859 GAGGCAGGACAACAGGGAGGAGG - Intronic
1070987532 10:80701214-80701236 CAGCCAGGCCAGCAGGTAGGTGG + Intergenic
1071154365 10:82672323-82672345 GAGACTGGAGAGGAGGAAGGGGG + Intronic
1071572015 10:86702448-86702470 CAGTCTGGTCAGCATCAAGGTGG - Intronic
1071718516 10:88120226-88120248 AAGGCGGGGGAGCAGGAAGGAGG + Intergenic
1072166172 10:92815078-92815100 CAGTCCAGGCAGCAGGAAGGAGG - Intergenic
1072190384 10:93073020-93073042 CCAGCTGGACAGCAGGGAAGGGG - Intergenic
1072661676 10:97367184-97367206 TGGGCTGGACAGCAGTAAAGGGG - Intronic
1072945641 10:99807752-99807774 CAGGATGCACAGCAAGAATGTGG + Intronic
1073770670 10:106731905-106731927 CAGGGAGGACAAGAGGAAGGAGG + Intronic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074405530 10:113177526-113177548 CAGGCTGGAGAGGAGGAACCTGG - Intergenic
1074435801 10:113433251-113433273 TAGCCTGGACAGCTGGGAGGAGG - Intergenic
1074819254 10:117166572-117166594 CAGGCTGGGCTGGCGGAAGGGGG - Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075702075 10:124476316-124476338 CTGGCCGGTCAGCTGGAAGGAGG + Intronic
1076368900 10:129939248-129939270 GAGGGTGGAGGGCAGGAAGGAGG - Intronic
1076442617 10:130490808-130490830 CTGGAAGGAGAGCAGGAAGGAGG - Intergenic
1076536260 10:131179530-131179552 CAACCTGGACAGCAGCCAGGGGG + Intronic
1077160820 11:1112091-1112113 GAGGCAGGACAGCAGGAGGTGGG - Intergenic
1077165239 11:1131822-1131844 CTGGCAGGAGAGCGGGAAGGTGG - Intergenic
1077376063 11:2205566-2205588 GAGGCTGGGCAGTAGGGAGGTGG - Intergenic
1077483405 11:2827091-2827113 CAGGCTGGGCTGCAGAGAGGAGG + Intronic
1077488837 11:2851224-2851246 CAGGCAGGAGAGCAGCAAGGAGG - Intergenic
1078156444 11:8803989-8804011 TAGGCTGGCCAGCAGGAAAGGGG + Intronic
1078349593 11:10581683-10581705 CAGGAAGGACAGGAGGAAGCAGG - Intronic
1078465755 11:11549126-11549148 CATTCTAGCCAGCAGGAAGGAGG - Intronic
1078708232 11:13765472-13765494 CATGCTGGGCAACAGAAAGGGGG - Intergenic
1079032265 11:16994553-16994575 GAGGCTGTACGGGAGGAAGGTGG - Intronic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1079450929 11:20599241-20599263 CGGGCTGTAGAGGAGGAAGGAGG - Intergenic
1081826749 11:46061676-46061698 TAGGTTGGACAGGAGGATGGAGG - Intronic
1081918421 11:46749520-46749542 CAGTTTGGAAATCAGGAAGGAGG + Intronic
1082810072 11:57474345-57474367 CAGGCAGGAGCACAGGAAGGTGG + Intronic
1083063403 11:59898255-59898277 CAGCAGGGTCAGCAGGAAGGCGG - Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083633699 11:64108939-64108961 CAGGCAGGTGGGCAGGAAGGAGG + Intronic
1083738084 11:64693166-64693188 CAGGCAGAACTGGAGGAAGGAGG + Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083773794 11:64883248-64883270 CAGGCTGCAGAGCAGCAAAGGGG - Intronic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084234146 11:67775487-67775509 CAGGCTGGTAAGCAGGGGGGTGG + Intergenic
1084328590 11:68416334-68416356 CTGGCTGAACAGCAAGAAGGTGG - Exonic
1084435121 11:69135031-69135053 CAGGCTGGACAGAGAGGAGGAGG - Intergenic
1084562222 11:69911444-69911466 CCGGCTGGACAGCACTGAGGAGG + Intergenic
1084891052 11:72237429-72237451 CAGGCTGGGGGGCAGGAAGATGG - Exonic
1084972111 11:72777666-72777688 CAGGCTGGAGGCCAGGAGGGAGG + Intronic
1085039394 11:73317967-73317989 AAGGCCTCACAGCAGGAAGGTGG - Intronic
1085052891 11:73388877-73388899 CAGGCAGGAAGGCAGGAAGAAGG - Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085303951 11:75474650-75474672 CAGGCTGGGGGGCAGGAAGGAGG + Intronic
1085405782 11:76261036-76261058 CAGGCCGGACAGCAGAAATCTGG + Intergenic
1087424384 11:97969554-97969576 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
1088099668 11:106141992-106142014 CAGGCAGCACAGCAGAGAGGGGG - Intergenic
1088300665 11:108354986-108355008 GTGGCTGGGCAGCAGAAAGGAGG + Exonic
1088355985 11:108944320-108944342 CTTGCTGGAATGCAGGAAGGAGG + Intergenic
1089377409 11:118004390-118004412 CAGGCTGGAGTGAAAGAAGGAGG + Intergenic
1089559697 11:119337688-119337710 CAGACTGGACTCCAGGCAGGAGG - Intergenic
1090089426 11:123681760-123681782 AAGGCAGGAAGGCAGGAAGGAGG + Intergenic
1090183580 11:124721458-124721480 AAGGCTGCACAGCAGGAAACTGG - Intergenic
1090467215 11:126945202-126945224 CACATTGGACAGCAGAAAGGTGG - Intronic
1091058195 11:132438557-132438579 TAGGGTGGGCAGCAGGAAGGTGG + Intronic
1091058226 11:132438706-132438728 TAGGGTGTGCAGCAGGAAGGTGG + Intronic
1091322671 11:134663136-134663158 CAGGCTTTGCAGCAGGGAGGTGG + Intergenic
1091335136 11:134760973-134760995 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1091626378 12:2124060-2124082 GAGGGAGGACAGCAGGAAGGAGG - Intronic
1092942956 12:13427649-13427671 GAGGCTGGACAGCTGGGAGGTGG + Intergenic
1093595204 12:20950892-20950914 CAGGCTGGACAGGATCAAGGTGG + Intergenic
1093957321 12:25236012-25236034 TGGGCTGCACAGCCGGAAGGAGG - Intronic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1094272258 12:28629910-28629932 CAGGCAGGCCGGCAGGCAGGCGG + Intergenic
1095621800 12:44265206-44265228 AAGGCTGCACAGCAGAAAGGAGG + Intronic
1096486215 12:51983270-51983292 CACTAGGGACAGCAGGAAGGAGG - Intronic
1096980247 12:55724469-55724491 CAGGCTGGCTGGCAGGTAGGAGG - Exonic
1098032092 12:66265529-66265551 CAGGCTGGACAGGACCCAGGGGG - Intergenic
1100518572 12:95351801-95351823 CAGGCTGGAGAGCAGGGTGGGGG + Intergenic
1100598714 12:96093725-96093747 CAGGATAGAAGGCAGGAAGGAGG + Intergenic
1100851416 12:98716274-98716296 AAGGCAGGACAGGTGGAAGGCGG - Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101299873 12:103468203-103468225 CAGGCTCAAAATCAGGAAGGTGG - Intronic
1101357755 12:103996602-103996624 CAGTCTGGACTGCAGGGAGGTGG - Intronic
1101758178 12:107637905-107637927 CAGTCTGGGAAGCAGGAATGGGG + Intronic
1101821226 12:108185707-108185729 CAGGGAGGAAGGCAGGAAGGAGG - Intronic
1102073627 12:110042709-110042731 CAGGGTGGGCAGCAAGAAGGGGG + Intronic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102152066 12:110695639-110695661 GAGGCAGGACAGCAGGGAAGGGG + Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102478254 12:113202665-113202687 CAGTCTAGCCAGCAGGAAGGAGG - Intronic
1103360404 12:120350355-120350377 CAGGGTGGAGGGCTGGAAGGAGG - Intronic
1103916194 12:124376832-124376854 CAGACGGGGCAGGAGGAAGGAGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104187407 12:126445929-126445951 CAGGCTGGAGTGCAGTGAGGTGG - Intergenic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104484191 12:129135411-129135433 CAGGATTGACTCCAGGAAGGTGG + Intronic
1104602333 12:130162274-130162296 CAGGCTGGGCTGCAGGCCGGGGG + Intergenic
1104613455 12:130249514-130249536 CTGGCTGAAAAACAGGAAGGAGG + Intergenic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1105534056 13:21247704-21247726 CAGCCTGGTCTGCAGGGAGGGGG - Intergenic
1105669833 13:22600806-22600828 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
1106156559 13:27163280-27163302 AAGGCTGGAGAGTAGGAAGGGGG - Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1107040821 13:35945410-35945432 CAGCCTGGCCAGCAGGGAGAAGG + Intronic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108304302 13:49115843-49115865 CAGGCTGGAAAGCAGGACTTTGG - Intronic
1108576941 13:51799016-51799038 GAGGCTGGACCCCAGCAAGGAGG + Intronic
1108592654 13:51924644-51924666 CAGGCAGGACGGAAGGAAGCAGG - Intergenic
1108831648 13:54486923-54486945 CATGCAGGTCACCAGGAAGGTGG - Intergenic
1108861755 13:54869104-54869126 CAGGCTGCACTGCAGCAAAGAGG - Intergenic
1109173986 13:59132621-59132643 CAGATTGCAAAGCAGGAAGGTGG - Intergenic
1109601570 13:64637167-64637189 CAAGCTGGAGAACAGGATGGTGG + Intergenic
1110394304 13:75012029-75012051 CACGCAGGAGGGCAGGAAGGTGG + Intergenic
1110978372 13:81867707-81867729 CAGGCGGGAGAGAAAGAAGGAGG - Intergenic
1111014136 13:82355310-82355332 CAGCCTGGACAACAGGAATGAGG - Intergenic
1111132651 13:83996946-83996968 CAGGATGGAAAGCAAGATGGAGG - Intergenic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112606315 13:100910213-100910235 AAGGCTGGCCAGAAGGAAAGTGG + Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113305772 13:109076813-109076835 CAGGCTGGAAGGCAGAAAAGAGG + Intronic
1113373936 13:109746433-109746455 CATGGTGGAGACCAGGAAGGAGG - Intergenic
1113457892 13:110461934-110461956 CACACTGGACAGCTGGATGGGGG + Intronic
1113786742 13:113006080-113006102 CAGGCTTGTGGGCAGGAAGGCGG - Intronic
1113905390 13:113817206-113817228 TGGGCTGGAGAGGAGGAAGGAGG - Intergenic
1114629709 14:24151254-24151276 CTGGCTGGACAGCAGGACCCTGG + Exonic
1114646145 14:24257272-24257294 GAGGCTGGACAGAAGGTAGCTGG + Intronic
1115027011 14:28757902-28757924 CATGCTGAAGAGCAGGGAGGAGG - Intergenic
1115472068 14:33778426-33778448 CAGGCTGGAATTCAGAAAGGAGG - Intronic
1115474260 14:33799098-33799120 CAGGCTGGAGTGCAGCAGGGTGG - Intronic
1115902275 14:38165295-38165317 CATCCTGGACAGCAAAAAGGTGG - Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1118112733 14:62740432-62740454 GGGGCTGGACAGCAGGAGGAGGG - Intronic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118439509 14:65799862-65799884 CAGCCTCAACAGCAGGCAGGAGG + Intergenic
1118893581 14:69928205-69928227 CAGGCTGGAAAGCAGGAGGTTGG + Intronic
1119430380 14:74563972-74563994 CAGGGTGGAGAACAGGAAGTGGG + Intronic
1119645193 14:76342872-76342894 AAGGCTTGAAAGCAGGAACGTGG - Intronic
1119724547 14:76914108-76914130 CAGGCAGGACCCCAGGAAGCTGG - Intergenic
1120502116 14:85309963-85309985 CCTGCTGGACAGGAGGAAAGAGG + Intergenic
1121325407 14:93016856-93016878 CAGGGTGGACAAGAGGATGGGGG - Intronic
1121358006 14:93231276-93231298 CAGCCAGGACAGGAGGCAGGAGG + Intergenic
1121539255 14:94712733-94712755 CAGGCAGGAAGGAAGGAAGGAGG + Intergenic
1121691305 14:95878874-95878896 CAGGCTAGAAAGCAGCAAGCTGG + Intergenic
1121740837 14:96251346-96251368 CAGGATGGCCAGCGAGAAGGTGG + Intronic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1122660027 14:103288932-103288954 CAGGCTGCACAGCAAGAGGTGGG + Intergenic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1123050236 14:105537893-105537915 AAGGCTGGCCTGCAGGCAGGGGG + Intergenic
1202936344 14_KI270725v1_random:91536-91558 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1124387999 15:29225776-29225798 CAGTTTGGAGAACAGGAAGGTGG - Intronic
1124458926 15:29871021-29871043 CTAGCTGGAGAGCAGGGAGGAGG + Intronic
1124636393 15:31367454-31367476 CAGCCTGGAGTGGAGGAAGGTGG - Intronic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1124910540 15:33915909-33915931 CATGCAGGTCACCAGGAAGGTGG - Intronic
1125513952 15:40307715-40307737 CAGGCAGAAGGGCAGGAAGGAGG + Exonic
1125568066 15:40693079-40693101 CAGGCTGGAGTGCAGGGACGTGG - Intergenic
1125691568 15:41600265-41600287 CAGGCTGGAATGCAGTAACGTGG - Intergenic
1125800226 15:42439508-42439530 CAGGCTGGTCAGCTGGAGAGTGG + Exonic
1126335487 15:47582622-47582644 CAGGCAGGACTGCAGGACTGAGG - Intronic
1126661851 15:51040023-51040045 CAGGCCGCACAGCAGGAGGTGGG + Intergenic
1127373261 15:58359605-58359627 CTGGCAAGACAGCAGGAAAGTGG - Intronic
1127846908 15:62878124-62878146 GAGGCTGGACAGCAGCCAGCAGG + Intergenic
1128087890 15:64898320-64898342 CAGGCTGGAAGGCAGTAAGGTGG - Intronic
1129113016 15:73349133-73349155 GAGGCTGGAGACCAGGAAGGAGG - Intronic
1129172307 15:73815699-73815721 GAGGCAGGACAGAAGGAAGCAGG + Intergenic
1129239479 15:74242978-74243000 CAGGGAAGACAGCAGGGAGGAGG - Intronic
1129426705 15:75468734-75468756 AAGGCTGGCCAACAGGTAGGAGG + Exonic
1130101845 15:80900309-80900331 AAGGCTGGACAGAATGCAGGGGG + Intronic
1131072512 15:89475046-89475068 CAGGCAGGAAGGAAGGAAGGCGG - Intronic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1131536048 15:93238904-93238926 CAGGATGGTGAGGAGGAAGGAGG + Intergenic
1131906835 15:97152087-97152109 CAGGCTGGGAAAAAGGAAGGAGG - Intergenic
1132208450 15:100002829-100002851 AGGGCTGGACAGCAGGAAGGAGG - Intronic
1132344873 15:101102135-101102157 CAGCCTGGACAGCTGTAGGGGGG + Intergenic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1133528909 16:6633968-6633990 CAGTCTGGACAGCAGTAGTGCGG - Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1133977397 16:10609168-10609190 CAGTCTGGCCAGCAGGGAGTGGG + Intergenic
1134234657 16:12455828-12455850 CAAGCAGGAAAGAAGGAAGGAGG - Intronic
1134241581 16:12510731-12510753 CAGGCTGGACAGCTGGGGGGTGG - Intronic
1134683552 16:16143252-16143274 AAGGCGGGACAGCCGCAAGGTGG + Intergenic
1134689236 16:16180191-16180213 CAGGCAGCACAGCAGGAGGTGGG - Intronic
1135565165 16:23506405-23506427 CTGACTGGACATCAGGAATGTGG - Intronic
1135603147 16:23800548-23800570 GAGGCTGTACAGGAGTAAGGTGG + Intergenic
1135804934 16:25534270-25534292 CAGGCTGCACAGCAGGTGAGTGG - Intergenic
1135912587 16:26574948-26574970 AAGGCAGGACAGCTGGAAGTGGG - Intergenic
1135943878 16:26846857-26846879 GAGGTTGCACAGCTGGAAGGAGG + Intergenic
1136290468 16:29268448-29268470 CAGACAGGACGGGAGGAAGGGGG + Intergenic
1136553833 16:30996700-30996722 CATGCTGGAGAGCGGGAAGCTGG - Exonic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139614915 16:68083140-68083162 CAGACCAGACAGCAGGCAGGAGG - Intergenic
1140298633 16:73734190-73734212 CGGGCTGCACAGCAGGAAGTGGG - Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141665105 16:85461901-85461923 CTGGGAGGAGAGCAGGAAGGAGG - Intergenic
1141777963 16:86136815-86136837 CAGCAGGGAGAGCAGGAAGGAGG + Intergenic
1142362041 16:89631966-89631988 TATGCTGGCCAGCAGGGAGGAGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142782208 17:2190064-2190086 GAGGATGGAAAGCAGGAAAGGGG + Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1142812245 17:2400776-2400798 CAGGCTGGCGGGCAGGCAGGAGG + Exonic
1142888487 17:2928216-2928238 CCGGTTAGACAGGAGGAAGGCGG - Intronic
1143108563 17:4541360-4541382 CGGGCTGGACTGCAGGGATGGGG - Intronic
1143183795 17:4998899-4998921 CAGGCTGGAGCCCAGGAATGTGG - Intronic
1143186173 17:5011827-5011849 CAGCCTGGACAGAAGCATGGAGG - Intronic
1143356667 17:6334808-6334830 GAGGAAGGACAGCAGGAAGGAGG + Intergenic
1143361483 17:6375057-6375079 CAGGCTGCACTCCAGGAAAGAGG + Intergenic
1143498082 17:7323767-7323789 GAGGCTGGGCAGGAGGAAGGTGG + Intronic
1143866292 17:9926247-9926269 CAGGAAGGAGAGCAGGGAGGCGG + Intronic
1143867887 17:9937355-9937377 CAGGCTGGAGAGATGGAAGCCGG + Intronic
1143981499 17:10874034-10874056 CAGACTGGACAACAGGATGGTGG + Intergenic
1144731813 17:17530611-17530633 CAGGCTGTGCGGCAGGAGGGAGG - Intronic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1145327966 17:21847753-21847775 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145328115 17:21848723-21848745 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145348652 17:22058135-22058157 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1145694772 17:26779137-26779159 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145923680 17:28630199-28630221 CAGGCTGGAGAGCAGTGATGCGG + Intronic
1146175788 17:30665772-30665794 CAGGCTGGATCGCAGGAACCTGG + Intergenic
1146349235 17:32081853-32081875 CAGGCTGGATCGCAGGAACCTGG + Intergenic
1146354903 17:32125749-32125771 CAGGGTGGACTTCAGGGAGGGGG - Intergenic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1146827124 17:36032555-36032577 CAGGCTGGAGAGGAGGGAGTTGG - Intergenic
1147524860 17:41212932-41212954 TAGGCTGGGCAGCAGGCAGCAGG - Intronic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1147590528 17:41680282-41680304 CAGGCAGCCCAGCAGGAAGAGGG + Intergenic
1147628957 17:41918111-41918133 CAGGCTCGACAGGAGGGCGGCGG + Intronic
1147906311 17:43825428-43825450 AAGGTTGCACAGCTGGAAGGAGG + Intronic
1147920949 17:43916766-43916788 AAGGCTGGACAACTGGAATGGGG - Intergenic
1147947766 17:44089885-44089907 CAGGCTGGAGTGCAGTAAGCAGG - Intronic
1148049652 17:44763461-44763483 CAGGCTGGACAGAAGTGAGGGGG - Intronic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148111186 17:45145303-45145325 AAGGCTGGACTGCAGCAAGCAGG + Intergenic
1148218336 17:45846033-45846055 CAGCAGGGCCAGCAGGAAGGAGG - Exonic
1148537769 17:48455166-48455188 CAGGATGGGGAGCTGGAAGGGGG - Intergenic
1149544733 17:57495052-57495074 CAGGCTGGGCTGCAGGGAGAGGG + Intronic
1149808302 17:59640439-59640461 CAGGCTGGAGTGCAGTAGGGCGG + Intronic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1150330206 17:64288170-64288192 AATGCTGGAAAGAAGGAAGGAGG + Intergenic
1150382585 17:64732544-64732566 GAGGCCGGAGAGCAGGGAGGAGG + Intergenic
1150773638 17:68062004-68062026 GAGGCCGGAGAGCAGGGAGGAGG - Intergenic
1151203039 17:72482988-72483010 CAGGCTGTACAGGAAGCAGGAGG + Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151711308 17:75808590-75808612 CAGGCTGGGATGCAGGAAGGAGG - Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1151835717 17:76581480-76581502 CAGGCTGGAGAGCCTGACGGAGG + Intronic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1151884738 17:76916822-76916844 GTGGCTGGAGAGGAGGAAGGTGG + Intronic
1152000034 17:77639557-77639579 CAGGCTGGACCCCAGGCAGGAGG - Intergenic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152430419 17:80245773-80245795 CAGTCAGGACAACAGGATGGAGG + Intronic
1152783724 17:82237558-82237580 CAGGATGGTGAGCAGGAAGGCGG - Exonic
1203192596 17_KI270729v1_random:203974-203996 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1203201961 17_KI270730v1_random:3409-3431 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1153163700 18:2238376-2238398 CAGGCGGGAAAGCAGGTTGGTGG - Intergenic
1153779771 18:8484343-8484365 TGGGCTGGACACCAAGAAGGAGG - Intergenic
1154092423 18:11378195-11378217 CAGCCTCGGCAGGAGGAAGGAGG - Intergenic
1154310877 18:13265417-13265439 CAGGCAGCACAGTGGGAAGGGGG - Intronic
1154315900 18:13303154-13303176 CATGCTGGACAGCAGCCATGTGG + Intronic
1154334152 18:13452543-13452565 GAAGCTGGAAAGGAGGAAGGCGG + Intronic
1154937808 18:21078647-21078669 CAGGCTGGACAGGGTCAAGGTGG + Intronic
1155553907 18:26996593-26996615 GAGGCTGCAAGGCAGGAAGGCGG + Intronic
1155871723 18:31037851-31037873 CAGGCTGGAGTGCAGGCTGGAGG - Intronic
1156097685 18:33555301-33555323 CAGGCTGGAGTGCTGGATGGAGG + Intergenic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157278025 18:46326054-46326076 CAGGCTGGCCAGCTCCAAGGCGG - Intergenic
1157327553 18:46679986-46680008 CAGGAGGGACAGCAGGAGAGGGG + Exonic
1157351435 18:46890646-46890668 CAGGATGGACAGGAGGAATTGGG + Exonic
1157591985 18:48841664-48841686 CAGGCTGGTGGGCAGGCAGGCGG + Intronic
1158387657 18:57013274-57013296 CAGGCCGTACAGCAGGAGGGTGG - Intronic
1158645933 18:59247099-59247121 AAGGCAGGACAGCTGGAAGCGGG - Intergenic
1158679685 18:59556107-59556129 GAGGCTGGATATCAGGAAGGAGG - Intronic
1158990724 18:62865881-62865903 GAGGCTGGAGGGCAGGAAGAAGG + Intronic
1159032052 18:63241575-63241597 TCTGCTGGACAGCAGGATGGGGG - Intronic
1159921367 18:74230191-74230213 CTGGCCGGTCAGAAGGAAGGAGG + Intergenic
1159943836 18:74428984-74429006 CAAGCTGGGCAGCAGGATGGAGG - Intergenic
1160322052 18:77905501-77905523 CTGGATGGACAGGTGGAAGGTGG + Intergenic
1160397345 18:78582323-78582345 CAGGCTTGGCAGCGGGGAGGTGG + Intergenic
1160536658 18:79598054-79598076 CAGGGTGGGCACCAGGTAGGAGG + Intergenic
1160585479 18:79911310-79911332 CAGGCAGGCCAGGAGGCAGGCGG + Intronic
1160865233 19:1253241-1253263 CAGGCTGGGCCGCAGGGTGGGGG + Intronic
1160991389 19:1861744-1861766 GAGGGTGGAGAGCAGGAGGGCGG - Intronic
1161051708 19:2167400-2167422 CAGGCAGGGCAGCAGGCATGCGG - Intronic
1161086868 19:2339493-2339515 CAGGCGGCTCAGCAGGAAGAGGG - Intronic
1161156643 19:2735280-2735302 CACGCGGAACAGCAGGAATGCGG + Intronic
1161237377 19:3204685-3204707 CAGGTGGGACAGCGTGAAGGCGG - Exonic
1161303255 19:3553208-3553230 CAGACTGGCCAGCAGGAACAGGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1162179639 19:8859283-8859305 CAAGCTGGACAGATGGATGGAGG - Intronic
1162983183 19:14252107-14252129 CAGGCTGGATCGCAGGAACCTGG - Intergenic
1163706294 19:18815546-18815568 CAGGCTGGAGTGCAGGCTGGTGG - Intergenic
1163775492 19:19215003-19215025 CAGGCTGCACAGCAGGGTAGAGG - Intronic
1164179532 19:22807078-22807100 CGGGCTTGACAGCAGGGTGGGGG + Intergenic
1164931199 19:32177577-32177599 CAGGCAGGAAGGCAGGCAGGAGG + Intergenic
1165116720 19:33533262-33533284 GAGGCTGGAAACCAGGAAGGAGG - Intergenic
1165158757 19:33803680-33803702 CAGGCAGGACACCAGCAAGGGGG - Intronic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1165435080 19:35790945-35790967 GAGGCTGGAGAACAGGGAGGAGG + Intergenic
1165549846 19:36574231-36574253 AAGGCGGGACAGCTGGAAGGTGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165898713 19:39158445-39158467 GAGGCTGGGCAGGGGGAAGGGGG - Intronic
1165924645 19:39319917-39319939 CAGCCTGGCCATCAGGATGGAGG + Intergenic
1166099896 19:40565678-40565700 CAAGCTGGGAACCAGGAAGGAGG + Exonic
1166113979 19:40641516-40641538 CAGGCTGGAGTCCAGGGAGGAGG + Intergenic
1166473750 19:43102633-43102655 CAGGCTGGACAGGGTCAAGGTGG + Intronic
1166487701 19:43227698-43227720 CAGGCTGGACAGGGTCAAGGTGG + Intronic
1166494534 19:43289570-43289592 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166672407 19:44718867-44718889 CAGGATGGAGAGCAGGGAGGAGG + Intergenic
1166862079 19:45816578-45816600 CTGGGTGGAGAGCAGGAAGGGGG + Intronic
1167024431 19:46904907-46904929 CTGGCTGGAGAACAGGAACGCGG - Intergenic
1167169014 19:47818641-47818663 CAGGCTCTACTGCAGGATGGGGG - Intronic
1168712965 19:58512232-58512254 CAAGCAGGACAGCAGGAAGGAGG - Intronic
1202684205 1_KI270712v1_random:33956-33978 AAGGCAGGACAGCCCGAAGGAGG - Intergenic
925121294 2:1420729-1420751 CAGGAGGGACAGAAGGATGGTGG + Intronic
925132081 2:1501418-1501440 CAGGATGGACAGGAAGGAGGGGG - Intronic
925189127 2:1868773-1868795 CAGCCTGCACCGCAGGGAGGAGG - Intronic
925562660 2:5214294-5214316 CAGGCTGGAATGCAGTAATGAGG - Intergenic
926145249 2:10393373-10393395 CAGGCTTCCTAGCAGGAAGGGGG - Intronic
926645515 2:15286446-15286468 CAGGCTGTACAGCAAGATTGTGG - Intronic
926692554 2:15747698-15747720 CAGCCTGGAGGGCGGGAAGGTGG - Intergenic
927420804 2:22928476-22928498 CACACTGGTGAGCAGGAAGGAGG - Intergenic
927602586 2:24457080-24457102 CATGATGGACAGCAAGAAAGGGG + Intergenic
927963002 2:27252086-27252108 CCAGCTGGACATCAGGGAGGGGG + Intergenic
928166166 2:28973511-28973533 AAGGCAGGAAGGCAGGAAGGAGG - Intronic
928168277 2:28986671-28986693 GAGGCTGGACAGCAACACGGAGG - Intronic
928668281 2:33573885-33573907 CAGCCTGGGCAGCAGGCTGGTGG + Intergenic
929781688 2:44961313-44961335 AAGGCAAGGCAGCAGGAAGGAGG - Intergenic
931346214 2:61449126-61449148 CAGCCTGGGCAACAGGAAGGAGG + Intronic
932134339 2:69215085-69215107 CAGCCTGTGCAGCAGGATGGAGG - Intronic
932221169 2:70000026-70000048 CAGGGAGGCCAGCAGGGAGGCGG - Intergenic
932361504 2:71111780-71111802 CAGACTGCAGTGCAGGAAGGGGG - Intronic
932545714 2:72707028-72707050 TAGGCTTGAGAGCTGGAAGGGGG - Intronic
932597134 2:73101092-73101114 GAGGGTGGACTGCAGGCAGGTGG + Intronic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
933701117 2:85256042-85256064 GAGGCTGGACAGCAAGTGGGAGG + Intronic
933721684 2:85401322-85401344 CCGTCTGGGCTGCAGGAAGGTGG - Exonic
933723007 2:85410129-85410151 CTGGCAGGACAGCAGGCTGGGGG + Intronic
934247514 2:90320896-90320918 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
934261810 2:91481705-91481727 AAGGCAGGACAGCCCGAAGGAGG - Intergenic
934646640 2:96062921-96062943 CGGGCTGGATGTCAGGAAGGTGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934840041 2:97619003-97619025 CGGGCTGGATGTCAGGAAGGTGG - Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
935603008 2:104941759-104941781 CAGGCTGGACAGGAGTGAGCAGG - Intergenic
935627494 2:105183488-105183510 GAGGCTGTCAAGCAGGAAGGTGG + Intergenic
936091541 2:109504718-109504740 TGGGCTGGTCAGCAGGCAGGTGG - Intergenic
936398373 2:112147605-112147627 CAGGGAGGGCAGCAGCAAGGCGG - Intronic
937372426 2:121309309-121309331 AAGGCAGGAAAGAAGGAAGGAGG + Intergenic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938108224 2:128547515-128547537 GATGCTGGACAGGAGGATGGTGG - Intergenic
938936985 2:136135843-136135865 CAGGCTGGAAATCAGGATAGTGG + Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
941231663 2:162917708-162917730 CAGGCAGCACAGCAGAAAAGGGG - Intergenic
942230320 2:173855057-173855079 CAGGAGGGACAGCTGGCAGGAGG - Intergenic
942922106 2:181387481-181387503 CAGGGTGGTCATCAGGAAGTAGG + Intergenic
942977370 2:182034489-182034511 GAGGCTGGAGAGCAGAGAGGTGG + Intronic
943521932 2:188962304-188962326 CAGGCAGGCAAGAAGGAAGGAGG + Intergenic
944571771 2:201052266-201052288 CAGCCTGGGCAACAGGAGGGGGG + Intronic
944612529 2:201426123-201426145 CAGGCTGCATAGCAGGAGGTGGG + Intronic
944793372 2:203156350-203156372 AAGGATGGACTGCAGCAAGGAGG - Intronic
944955535 2:204803776-204803798 CAGGAAGGAAAGAAGGAAGGAGG + Intronic
944970302 2:204985178-204985200 CAGGCAGGAGGGAAGGAAGGAGG - Intronic
945086278 2:206135629-206135651 CAGGCTGGAGTGCAGTACGGTGG - Intronic
945187475 2:207154353-207154375 CAGACTGGACAGAAAGAAAGGGG + Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946104945 2:217360857-217360879 CAGGGTGGGCAGCAGGGATGGGG - Intronic
946145264 2:217725790-217725812 CCGGCTGGAGAGCAGGGAGCAGG + Intronic
946285860 2:218702012-218702034 GAGGCTGGACCGCAGGAATCTGG - Exonic
946399132 2:219459664-219459686 CAGGCTGGACAGTACTGAGGAGG - Intronic
946989095 2:225307957-225307979 CAGGCTGGAGTGCAGGGCGGTGG - Intergenic
947279858 2:228438435-228438457 AAGGCAGGAAGGCAGGAAGGTGG - Intergenic
947421889 2:229948670-229948692 CATTCTAGACAGTAGGAAGGAGG - Intronic
947604056 2:231472458-231472480 CAGGGAGGACCCCAGGAAGGTGG - Intronic
947767292 2:232645922-232645944 GAGGCTGGAAAGCTGGGAGGTGG - Intronic
948461604 2:238132423-238132445 AAGGCTGGAGAGCAGGGACGTGG + Exonic
948846586 2:240685727-240685749 CAGGCCGGGCACCTGGAAGGAGG + Intergenic
948847275 2:240689007-240689029 CAGGCCGGGCACCTGGAAGGAGG - Intergenic
949037961 2:241827058-241827080 CAGCCTGGTAAGCAGAAAGGTGG - Intergenic
1169331976 20:4723223-4723245 AAGGCTGCACAGCGGGGAGGTGG - Intronic
1169496627 20:6122389-6122411 AGGGATGGAGAGCAGGAAGGAGG + Intronic
1170003995 20:11646471-11646493 CAGGGAGGACACCAGGGAGGAGG + Intergenic
1170845062 20:19955363-19955385 CAGCCTGGACAACAGGAGTGAGG - Intronic
1171446097 20:25205822-25205844 CAGGCGGGACCTCAGGAAGGAGG + Intronic
1171518239 20:25756575-25756597 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1171558620 20:26099629-26099651 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172204960 20:33156801-33156823 GAGGCTGGGCACCAGGCAGGAGG + Intergenic
1172424633 20:34846960-34846982 AAGACTGGATAGCAGTAAGGGGG - Intronic
1172543637 20:35742143-35742165 CACGCGGGAGAGCAGGACGGCGG + Intronic
1172765964 20:37351048-37351070 CAGGCTGTACTGTGGGAAGGAGG - Intronic
1173197165 20:40925106-40925128 GGGGCTGGAGAGCAGGAGGGAGG + Intergenic
1173464866 20:43272846-43272868 GAGGCGGGGCAGGAGGAAGGAGG - Intergenic
1174096115 20:48090963-48090985 AAGGCTGCACTGCAGGAAAGCGG - Intergenic
1174918480 20:54677539-54677561 CAGCCTGGAGATCAGGGAGGAGG + Intergenic
1175114547 20:56672992-56673014 CACACTGGAAAGCAGGAGGGAGG - Intergenic
1175178281 20:57126947-57126969 CAGGCTGGGCAGGAGAGAGGAGG + Intergenic
1175226068 20:57444672-57444694 GAGGATGGAGGGCAGGAAGGAGG + Intergenic
1175550950 20:59817317-59817339 CAGGCTGGTCAGCAGCCAGACGG - Intronic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175769441 20:61614334-61614356 CAGGCTGTTGAGCAGGAGGGCGG + Intronic
1176115079 20:63428669-63428691 CAGCAGGGACAGCAGGGAGGAGG + Intronic
1176212062 20:63929494-63929516 CCAGCTGGACAGCACGAAGTAGG - Exonic
1176272701 20:64244740-64244762 TAGGGTGGAAATCAGGAAGGAGG - Intergenic
1176372323 21:6069517-6069539 CAGGCTGGGCTTCAGGAAGCAGG + Intergenic
1176652396 21:9562986-9563008 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1178894140 21:36544677-36544699 CAGTCGGGTCAGCAGGAAGGAGG - Intronic
1179024625 21:37669219-37669241 AAGGCAGGACAACTGGAAGGTGG - Intronic
1179052609 21:37901010-37901032 CAGGAAGGAGAGAAGGAAGGGGG - Intronic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179194990 21:39156381-39156403 CAGGCTGGAGAGCAGTAGCGTGG + Intergenic
1179503567 21:41824892-41824914 CATGCTGGAAGGCAGGACGGCGG + Intronic
1179555699 21:42174233-42174255 CAGGCTGGAGAGGAGGCAGGTGG + Intergenic
1179751195 21:43469022-43469044 CAGGCTGGGCTTCAGGAAGCAGG - Intergenic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1179999459 21:44988745-44988767 CAGGCTGTGCAGCACGCAGGAGG - Intergenic
1180587923 22:16909803-16909825 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180854995 22:19040101-19040123 CAGGCTGCAGAGCAGGGTGGGGG - Intronic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1181632452 22:24158280-24158302 CAGGCTGGTCTCCAGGAAGCAGG - Intronic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182294495 22:29305188-29305210 GAGGCTGGAGTGCAGGGAGGTGG - Intergenic
1182446512 22:30392806-30392828 CAGGCTGGACTGCAGAAGTGAGG + Intronic
1182588668 22:31362298-31362320 AAGGCAGGACAACTGGAAGGAGG + Intergenic
1183001438 22:34862754-34862776 CAGGCTGGTGAAAAGGAAGGAGG - Intergenic
1183280373 22:36929022-36929044 GAGCTTGGACAGCAGGAGGGGGG + Intronic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183456461 22:37925763-37925785 AAGCCAGGACAGCAGGCAGGTGG + Exonic
1183484298 22:38081153-38081175 CACGATGGACAGCAGGAAGGCGG + Exonic
1183977916 22:41523827-41523849 CAGGAAGGACATCAAGAAGGGGG + Exonic
1183986902 22:41575089-41575111 CAAGCTGGCCAGGAGGTAGGTGG + Exonic
1184099486 22:42334546-42334568 CAGGCTAGGCTGCAGGGAGGTGG + Intronic
1184169887 22:42752566-42752588 CCAGCTGGACAGCAGGGAGGGGG - Intergenic
1184226997 22:43134807-43134829 GAGGCTGGACCGCAGGAACCAGG + Intronic
1184279576 22:43429310-43429332 CAGCCTGGAGTGCAGGGAGGGGG + Intronic
1184366503 22:44055156-44055178 TAAGCTGGATAGCAGGAACGTGG - Intronic
1184366976 22:44057959-44057981 CAGACAGGAAAGCAGGCAGGAGG - Intronic
1184468323 22:44681871-44681893 CAGCCTGGAGGGCAGGCAGGAGG + Intronic
1184528583 22:45040263-45040285 CATCCTGGACAGCAGGGAGTAGG - Intergenic
1184565575 22:45289787-45289809 AAGGATGGAAAGGAGGAAGGAGG - Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184651543 22:45921469-45921491 CAGGCTGGGCAGGAGAAAGGTGG + Exonic
1184661373 22:45967114-45967136 CAGGCTGGCCGGCAGGGTGGGGG - Intronic
1184674890 22:46036228-46036250 GAGGCCGGACAGCCGGGAGGCGG + Intergenic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184767392 22:46578748-46578770 AAGGGTGTGCAGCAGGAAGGAGG - Intronic
1185153519 22:49179827-49179849 CAGGCTCGATATCAGGAATGAGG - Intergenic
1185277803 22:49957234-49957256 CAGCCTGGGGAGCAGGAATGGGG + Intergenic
949861203 3:8506412-8506434 AAGGCTGGGGACCAGGAAGGAGG + Intronic
950122116 3:10488801-10488823 GAGGAAGGAGAGCAGGAAGGAGG - Intronic
950472960 3:13197824-13197846 CAGGCTGGACATGAGCTAGGTGG + Intergenic
950500100 3:13358332-13358354 CAGGCTCCACCGCAGGAAAGGGG + Exonic
950658702 3:14453217-14453239 CCGGCTGGACGGCAGCAGGGCGG + Intronic
951752536 3:26053607-26053629 CAGGCAGGCAAGCAGGCAGGCGG + Intergenic
952374966 3:32759342-32759364 CAATCTGGACACCAGGAAAGAGG - Intronic
952382937 3:32818415-32818437 CAGGTTGCTAAGCAGGAAGGCGG - Exonic
952737865 3:36707862-36707884 CCTGCTGGCCAGCAGGATGGAGG + Intergenic
953171244 3:40509807-40509829 CAGGCTGCAACACAGGAAGGGGG - Intronic
953436915 3:42884709-42884731 CAGGCAGCACAGCAGGAAATGGG - Intronic
953855544 3:46497061-46497083 TGGGCTGGAGAGGAGGAAGGAGG + Intergenic
954082812 3:48222357-48222379 CAGGAGGGACAGCAGGAGAGTGG + Intergenic
954385928 3:50243837-50243859 CAGGCAGGACAGCAGGCAGACGG + Intronic
955596121 3:60592588-60592610 CTGCCTGGGCAGCAGGATGGAGG + Intronic
955660450 3:61293452-61293474 GAGGCTGGAGAGGAGGATGGAGG + Intergenic
956166001 3:66398700-66398722 TAGGCTGCGCAGCAGGAGGGGGG + Intronic
956856954 3:73284577-73284599 CCGGCTGGACTGCACGGAGGTGG - Intergenic
957846488 3:85743557-85743579 CAGGCTGGTTAGGAGGCAGGAGG - Intronic
960358179 3:116678775-116678797 CAGGATGGAGAGCTGGAATGGGG - Intronic
960611159 3:119555959-119555981 CAGACTGGGCTGCAGGAAGGAGG - Intronic
961325005 3:126104596-126104618 CCTGGTGGACACCAGGAAGGTGG + Intronic
961394469 3:126577612-126577634 CTGGCTGGAGAGCAGGGAGCTGG + Intronic
961395075 3:126580795-126580817 CAGGCTGGAAAGCATGAAGATGG + Intronic
961577230 3:127847435-127847457 CATGCTTGACAGAGGGAAGGAGG + Intergenic
961809208 3:129512358-129512380 CAGGCTGTGCAGCAGGAACCTGG - Exonic
961883770 3:130082030-130082052 CAGGCTGGTAAGCAGGGGGGTGG + Exonic
962328262 3:134454090-134454112 CAGGGTAGACCCCAGGAAGGAGG - Intergenic
962920957 3:139950050-139950072 GAGGCAGGGCAGCAGGAAGAGGG + Intronic
963300869 3:143595853-143595875 CAGGTTTGGCAGCAGAAAGGAGG + Intronic
963557681 3:146813627-146813649 CAGCCAGGACAGCAGGAATCTGG + Intergenic
966563737 3:181352434-181352456 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
966688723 3:182723049-182723071 CATGCTGGACAGCATTGAGGTGG + Intergenic
966716916 3:183021963-183021985 GAAGGTGGACAGTAGGAAGGTGG - Intronic
967187988 3:186961658-186961680 GAGGCTGGTCAGCTGGAAAGGGG + Intronic
967647117 3:191938960-191938982 CAGGCTGTAGAACAGGAAGGGGG - Intergenic
967891446 3:194367038-194367060 CATGCTGGGCAGGGGGAAGGTGG - Intronic
968081121 3:195847603-195847625 CAGGCTGGAAAGGAGGGAAGGGG - Intergenic
968664426 4:1813352-1813374 CCGGCTGGGCAGGAGGATGGAGG + Exonic
968725180 4:2243788-2243810 CAGTTTGGACAGGAGGAAGTGGG + Intergenic
968917103 4:3501359-3501381 CAGGCAGGACAGCCGGGAGGCGG - Intronic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
969338091 4:6523316-6523338 CAGGCCACACAGCAAGAAGGAGG - Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
970994130 4:22246242-22246264 CAGGCTTGACAGCAGAAGGAAGG + Intergenic
972865758 4:43230117-43230139 CAGTCTGGAAAGGAGCAAGGTGG + Intergenic
973888463 4:55346407-55346429 CAGTAGGGTCAGCAGGAAGGCGG - Exonic
973903227 4:55499619-55499641 CAGGCCGCACAGCAGGAGGTAGG - Intronic
975017102 4:69435644-69435666 AAGGATGGAGGGCAGGAAGGAGG + Intergenic
976094899 4:81498282-81498304 CAGGCAGGCCAGCAGGTAGGCGG + Intronic
976711287 4:88074183-88074205 CAGGCTGGAGTGCAGGAGTGCGG + Intronic
977914347 4:102574596-102574618 CAGGCTGCAGCACAGGAAGGAGG - Intronic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
978710690 4:111777026-111777048 AAGGCAGGACAGAAGAAAGGAGG - Intergenic
979576517 4:122297905-122297927 CAGCAGGGACAGCAGGAGGGAGG + Intronic
979878239 4:125920830-125920852 CAGGACTGACAGCATGAAGGCGG - Intergenic
979969093 4:127112939-127112961 TAGGCTTGAAAGCAGAAAGGAGG + Intergenic
981081797 4:140644300-140644322 CGGGGTGGACAGCAGGGAGTGGG + Intronic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
982072435 4:151707178-151707200 CAAGCTGGTCAGAAAGAAGGTGG + Intronic
982353558 4:154443026-154443048 TAGGCTGGACAGAGGGGAGGAGG - Intronic
983412432 4:167417937-167417959 CAGGCTGGACAGGGCCAAGGTGG - Intergenic
984208007 4:176809911-176809933 GAGGCTGGAAAGGAGGAAAGTGG - Intergenic
984781731 4:183532701-183532723 TAGGCTGGAAAGCAGAATGGAGG - Intergenic
984805521 4:183747955-183747977 CAAGCTGGAAACCAGGAAGTAGG + Intergenic
984823390 4:183904230-183904252 CAGGCAGCACAGCAGGAGGTGGG - Intronic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985285753 4:188335131-188335153 CAGCCTGGAGAGCAGGAGGGAGG + Intergenic
985546893 5:514431-514453 CAGGGTGGGCCCCAGGAAGGGGG - Intronic
985563457 5:603539-603561 CAGGCTGGACACCAGGCAGACGG + Intergenic
985646071 5:1085282-1085304 CAGGATGGACAGCACGACGCAGG + Exonic
986190286 5:5490851-5490873 CAGACTTGAAAGCAGGCAGGAGG + Intergenic
986464674 5:8008972-8008994 CAGGTTGGACATCAGCAAGATGG - Intergenic
986826708 5:11530432-11530454 AGGGCTGGAAAGCAGGGAGGGGG - Intronic
987287343 5:16469798-16469820 CAGGCTGTACAGAAGCATGGTGG - Intergenic
990415022 5:55578206-55578228 AAGGCTGGATAACAGGAAAGTGG - Intergenic
990948653 5:61275388-61275410 CAGGCTGGGCAGCAGACAGTAGG - Intergenic
991166009 5:63566068-63566090 CAGACTGGACAGGATCAAGGTGG - Intergenic
991489299 5:67166744-67166766 CAGGGTGGAGACCCGGAAGGAGG - Exonic
992071138 5:73150660-73150682 CAGGGAGGACAGCAGAAAAGAGG - Intergenic
992197443 5:74354094-74354116 GAAGCTGGCCAGCAGGTAGGTGG - Intergenic
993140547 5:84027702-84027724 CAGGATAGACAGCAGGGAGTGGG + Intronic
993401379 5:87456949-87456971 AAGCCTGGACAGCAGCCAGGTGG + Intergenic
994841733 5:104932632-104932654 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
995240865 5:109884525-109884547 CAGCCTGTACAGGAGGACGGAGG + Exonic
995715967 5:115082172-115082194 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997247980 5:132367377-132367399 CAGGCTGGAGTGCAGTGAGGTGG - Intergenic
997283541 5:132663075-132663097 CAGGCTGCTCCCCAGGAAGGGGG + Intergenic
998033326 5:138892038-138892060 AAGGCTGGACAACTCGAAGGAGG - Intronic
998286224 5:140863300-140863322 CAGGCTGGACACCACGCAGATGG - Intronic
998367229 5:141639445-141639467 CACACTGGACAGCAGGGAGGAGG - Exonic
998374270 5:141680953-141680975 CAGCCTAGATAGGAGGAAGGAGG + Intronic
998374501 5:141682023-141682045 GAGGCCGGGCAGCAGGAGGGAGG + Intronic
998389740 5:141779806-141779828 CAGGCTGGGAAGCAGGGGGGAGG + Intergenic
998509214 5:142697507-142697529 CAGGGAGGAGAACAGGAAGGCGG + Intronic
999287579 5:150403262-150403284 CCGGGTGGACAGCAGGGATGTGG + Exonic
1000351764 5:160357980-160358002 CAGGCTCCACAAGAGGAAGGCGG + Intronic
1000487864 5:161870520-161870542 CAGGCTGGACTGCAATAACGCGG - Intronic
1001087801 5:168714086-168714108 CAGCTAGGACAGCAGGAAGATGG + Intronic
1001200647 5:169713124-169713146 GAGGCTGTACAGAAGAAAGGGGG - Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001577079 5:172771416-172771438 CAGGCCGGACAGCAGGGCGGGGG - Intergenic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1002389500 5:178898703-178898725 CATGCAGTACAGGAGGAAGGGGG - Intronic
1002407150 5:179043978-179044000 CAGGCAGGACATCTTGAAGGTGG + Intergenic
1002764615 6:228204-228226 CAGGCTGCCCCGCAGGATGGTGG + Intergenic
1003042336 6:2699915-2699937 CAGGCTGGATAGAAGAATGGAGG - Intronic
1003054622 6:2806897-2806919 CTGTCTGGACAGCAGGCAAGAGG + Intergenic
1003472689 6:6451924-6451946 GAGGCAGGATAGCAGGGAGGGGG - Intergenic
1004125612 6:12869622-12869644 CACTATGGTCAGCAGGAAGGAGG - Intronic
1004330584 6:14717039-14717061 CAGCCAGGACAGCAGCAAGTAGG + Intergenic
1004482427 6:16033509-16033531 CAGGCAGGACAGCAGAGAAGGGG - Intergenic
1005083452 6:21980577-21980599 CAGGCTGCAGAACAGGAAGAAGG - Intergenic
1005083529 6:21980967-21980989 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083622 6:21981545-21981567 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083637 6:21981623-21981645 CAGGTTCCAAAGCAGGAAGGAGG - Intergenic
1005149747 6:22735355-22735377 CAGGCTGGAGTGCAGAAATGTGG + Intergenic
1005881716 6:30067373-30067395 CAGGGAGGAGAGGAGGAAGGGGG - Exonic
1006112065 6:31753447-31753469 CAGGGTGGAGGGCAGGGAGGTGG + Intronic
1006169160 6:32083175-32083197 CTGTCTGGACTCCAGGAAGGAGG - Intronic
1006174700 6:32114930-32114952 CATCCTGGACAGCAAGAAGAGGG + Intronic
1006341296 6:33448591-33448613 GAGGCTGGGCAGCAGGCAGCTGG - Intronic
1007086477 6:39150721-39150743 CAGACTGGACAGCAGTATCGTGG - Intergenic
1007114352 6:39332924-39332946 CAGGCTGCAGCCCAGGAAGGGGG - Exonic
1007397906 6:41587770-41587792 CTGGGAGGACAGCAGGGAGGTGG - Intronic
1007835522 6:44671177-44671199 GAGGCTGCAGAGAAGGAAGGTGG - Intergenic
1007954379 6:45902845-45902867 CAGGCTGGCCGGCCGAAAGGTGG + Exonic
1008892070 6:56506435-56506457 CAGGATGGACTGCAGGTAAGGGG - Exonic
1010198346 6:73262048-73262070 CAGCCTAGGCAGCAGGAAAGAGG + Intronic
1010403959 6:75481485-75481507 CAGGAAGGAGAGCAGGGAGGTGG - Intronic
1010832706 6:80550932-80550954 CAGGCAGGACAGCAGAGAAGAGG + Intergenic
1013412897 6:109897607-109897629 CAGGCAGCACAGCAGAAAAGGGG + Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1014138730 6:117917239-117917261 GAGGCTGGAGAGCAGGAAACAGG + Intronic
1014198316 6:118583079-118583101 CAGGCTGGACAGGGTCAAGGTGG - Intronic
1017136903 6:151155395-151155417 CAGGCTGGAGTGCAGGCTGGAGG + Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018400025 6:163413587-163413609 GAGGCTGGAAAGCAGCACGGCGG - Intergenic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1018743515 6:166747616-166747638 GAGGCTGGGCAGGGGGAAGGGGG + Intronic
1018765135 6:166926912-166926934 CAGGATGGAGAGCAGCCAGGAGG - Intronic
1018804601 6:167249044-167249066 GAAGCCAGACAGCAGGAAGGAGG - Intergenic
1019063083 6:169271232-169271254 CAGGCCCCAGAGCAGGAAGGCGG + Intergenic
1019131766 6:169882221-169882243 CATGCTGGACAACGGGAGGGCGG + Intergenic
1019357068 7:586040-586062 CATGCCAGTCAGCAGGAAGGAGG - Intronic
1019426878 7:982176-982198 GAGGCTGTACAGCAGGATAGAGG + Intergenic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019595767 7:1857650-1857672 CCAGCTGGACAGGAGGAAGAGGG + Intronic
1019755053 7:2762773-2762795 CAGGCTGTACAAAAGGGAGGAGG + Intronic
1020059859 7:5144037-5144059 CAGGTTGGAGAGGAAGAAGGGGG + Intergenic
1020144783 7:5634172-5634194 GAGGCTGGCCAGCAGGCACGTGG - Intronic
1020367640 7:7397249-7397271 CAGACTGGAGTGCAGGAAGATGG - Intronic
1021578654 7:22129083-22129105 GATGCTGGTCAGAAGGAAGGTGG + Intronic
1021982567 7:26068901-26068923 GAGGCTGGAGGGCAGGAAGAGGG - Intergenic
1022324375 7:29317792-29317814 CAGTCTGGACAACATGGAGGAGG + Intronic
1022536553 7:31102187-31102209 CGGGGTGGACAGCAGGCATGAGG - Intronic
1022759841 7:33336017-33336039 CTGGCTGAAGACCAGGAAGGAGG - Intronic
1022942462 7:35253906-35253928 CAGTCTGCACAGCCCGAAGGCGG + Exonic
1023841144 7:44098257-44098279 CATCCTGGCCAGCAGAAAGGAGG - Intergenic
1023939809 7:44762131-44762153 CAGGGTGGAGAGCAGGACGTGGG + Intronic
1024323099 7:48089055-48089077 GAGGGTGGAGAGGAGGAAGGCGG + Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024486598 7:49926802-49926824 AATGCAGGAGAGCAGGAAGGAGG + Intronic
1025279063 7:57613913-57613935 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1025305668 7:57851587-57851609 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1025832201 7:65062169-65062191 CAGGCTGCAGAGCAGGGATGGGG + Intergenic
1025919879 7:65901598-65901620 CAGGCTGCAGAGCAGGGATGGGG + Intronic
1026791499 7:73335429-73335451 CAAGCTGGGCAGCAGGACAGAGG + Intronic
1026877389 7:73887369-73887391 CAGGCAGGGCAGCAGGACTGGGG - Intergenic
1026950654 7:74344259-74344281 CAGGGTTGGCAGCAGCAAGGGGG + Intronic
1027265271 7:76491726-76491748 CAGGCTGGACTGCAGTGATGTGG + Intronic
1027316640 7:76989842-76989864 CAGGCTGGACTGCAGTGATGTGG + Intergenic
1029274290 7:99395041-99395063 CAGGATGGACAGCAGTGGGGAGG - Exonic
1031098981 7:117455149-117455171 GAGGCTGGGAAGCGGGAAGGTGG + Intergenic
1031729784 7:125285075-125285097 AAGGCAGGACAGAAGGAGGGAGG + Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032095396 7:128935647-128935669 CAAGATGGACAGTGGGAAGGGGG + Intergenic
1032457698 7:132086343-132086365 CATGCTTGTCAGCAGGATGGAGG + Intergenic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1032721600 7:134554631-134554653 GAGGCTTGCCAGGAGGAAGGTGG + Intronic
1033626776 7:143117995-143118017 CAGGCTGGATAGCTTGTAGGTGG + Intergenic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034272862 7:149811844-149811866 CAGGCTGGACAGGCTGAAGATGG - Intergenic
1034884998 7:154792596-154792618 CAGGATGGAGAGCAGGGGGGAGG + Intronic
1035226688 7:157437844-157437866 CAGGCTGGACAACTGGGTGGGGG - Intergenic
1036609047 8:10334103-10334125 CAGGCAGGAAAGCAGGCAGTAGG - Intronic
1036749047 8:11431734-11431756 CAGCCTGGACAGTTGGAGGGTGG + Intronic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1038012071 8:23483223-23483245 CCGGCTGGACAGCACGAGGTAGG + Intergenic
1038368331 8:26960929-26960951 CAGGCTGCACAGCAGGTGAGTGG + Intergenic
1039151546 8:34512236-34512258 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1039428364 8:37505595-37505617 CAGGCAGGACAGCTGGAATCTGG - Intergenic
1039560690 8:38510339-38510361 CAGGGTGGAAAGGAGGGAGGGGG + Intergenic
1039880818 8:41624508-41624530 CGGGATGCACAGCAGGCAGGTGG - Exonic
1039966897 8:42290314-42290336 CAGGTGGGACACCAGGAAGAGGG + Intronic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041412414 8:57571465-57571487 CCAGGTGGACAGCAGCAAGGGGG - Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1041928656 8:63264570-63264592 CAGACTACAAAGCAGGAAGGAGG - Intergenic
1042874112 8:73425018-73425040 CATGCTGGACAACAGCCAGGTGG + Intronic
1044261871 8:90134495-90134517 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
1044416460 8:91945581-91945603 CAGGCTGCAAAGCAGGAGGTAGG - Intergenic
1044984592 8:97746452-97746474 GAGGCTGTGCAGCTGGAAGGTGG + Intergenic
1045003265 8:97896475-97896497 CAGGCAGGACAACAGGGATGGGG + Intronic
1046193758 8:110833048-110833070 CAGGCTGGACAGGGTCAAGGTGG + Intergenic
1046535901 8:115509843-115509865 CAGGCAGGACAGCAGAGTGGTGG - Intronic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048462610 8:134635089-134635111 CAGGCTGCACAGCAGGTGAGTGG - Intronic
1048897253 8:139003214-139003236 GAGTGTGGACAGCAGGAGGGTGG - Intergenic
1049001423 8:139827682-139827704 CAGCCAGGACAGCAGCAAGAGGG + Intronic
1049270410 8:141692689-141692711 CGGGCAGGCCAGCAGGCAGGTGG + Intergenic
1049285848 8:141774842-141774864 CTGGCTGGAGAGGAGGACGGAGG - Intergenic
1049766883 8:144359027-144359049 CAGGCAGGGAAGCAGGAAGCCGG - Exonic
1050309736 9:4340558-4340580 GTGGCAGGACAGCAGGAATGAGG + Intronic
1050901816 9:10959883-10959905 AAGGCAGGACAGCAGGAGTGGGG - Intergenic
1051129265 9:13841325-13841347 AAGGAGGGAGAGCAGGAAGGAGG + Intergenic
1051286421 9:15501954-15501976 CACGCTACACAGCAGGAGGGAGG + Intronic
1051532071 9:18115344-18115366 CAGGCAGGAAGGCAGGCAGGGGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051900439 9:22032958-22032980 CAGGCTGCACAGCAGAAGGTGGG + Exonic
1052424700 9:28289835-28289857 CAGGCTAGAAACCAGGAAGCAGG + Intronic
1053109425 9:35444765-35444787 AAGTCAGGAAAGCAGGAAGGTGG - Intergenic
1053696837 9:40647381-40647403 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1054308088 9:63446614-63446636 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1054406821 9:64770605-64770627 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1054440446 9:65256071-65256093 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1054489961 9:65765853-65765875 AAGGCAGGACAGCCCGAAGGAGG - Intergenic
1055708349 9:79033002-79033024 GAGGCTGGAAGGCAGGAAGAAGG + Intergenic
1056251677 9:84754804-84754826 CAGATGGGACAGGAGGAAGGTGG + Intronic
1056862808 9:90202817-90202839 CCAGCTGGATACCAGGAAGGGGG - Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057269000 9:93636628-93636650 CTTGCTGGAAAGCAGGAAGCAGG + Intronic
1057510853 9:95678543-95678565 CAGCCTGGACATCATGAATGGGG - Intergenic
1057825912 9:98371935-98371957 AGGGCTGGGCAGCAGGAAGAAGG - Intronic
1057843149 9:98502358-98502380 CAGGCTTCAGAGCAGGGAGGAGG - Intronic
1058004898 9:99904461-99904483 CAGGCTGGAGTGCAGGCTGGTGG + Intergenic
1058721475 9:107768503-107768525 TAGGGTGGAGAGCAGGAAGGGGG - Intergenic
1059563904 9:115363527-115363549 CAGGCTGTAATGCAGCAAGGGGG + Intronic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1060729788 9:126030076-126030098 CAGGCTGGAAAGTTGGGAGGAGG - Intergenic
1060925451 9:127452245-127452267 AGGGCTGCACATCAGGAAGGGGG + Intronic
1060988655 9:127835929-127835951 CAGGCTTGAGGGCAGGTAGGAGG + Intronic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1061887482 9:133599110-133599132 GAGGCAGGACAGGAGGAGGGTGG - Intergenic
1062191735 9:135251396-135251418 CAGCCTGCACAGCAAGAAGTGGG + Intergenic
1062197100 9:135280371-135280393 CAGGTTGGACGGCAGGAAGCCGG + Intergenic
1062291114 9:135794832-135794854 CAGTCATGACATCAGGAAGGTGG + Intergenic
1062376142 9:136262740-136262762 CAGGCTGGGCTGCAGGAGAGGGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062526252 9:136979130-136979152 CAGGTGGGACAGCGGGCAGGTGG + Exonic
1062599440 9:137313335-137313357 CAGGGTGGCCGGCAGGCAGGAGG - Intronic
1202779289 9_KI270717v1_random:21040-21062 AAGGCAGGACAGCCCGAAGGAGG + Intergenic
1203617111 Un_KI270749v1:75778-75800 AAGGCAGGACAGCCCGAAGGAGG - Intergenic
1203630124 Un_KI270750v1:66527-66549 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1185643586 X:1601324-1601346 CAGGCGGGCCAGCAGCAGGGAGG + Exonic
1185726622 X:2426863-2426885 GAAGATGGACAGAAGGAAGGAGG - Intronic
1186049155 X:5571394-5571416 CAGGCCGTTCAGCAGAAAGGTGG - Intergenic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186207223 X:7213468-7213490 CAGGCAGGAGGGCAGGAAGGTGG + Intergenic
1186276739 X:7947274-7947296 CAGGCAGCACAGCAGAAAAGGGG - Intergenic
1186991727 X:15076844-15076866 CAGGCTATACAGCAAGCAGGTGG + Intergenic
1189316856 X:40062676-40062698 CAAGCTGGGAAGCAGGCAGGCGG + Intronic
1189558948 X:42172893-42172915 CAGGCTGAACACCAGCAAGGTGG + Intergenic
1190650420 X:52563517-52563539 GGGCCTGGACAGGAGGAAGGAGG - Intergenic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1190968517 X:55326442-55326464 CAGGCTCAACAGCAGAATGGGGG - Intergenic
1191127720 X:56975298-56975320 AAGGCAGGACAACTGGAAGGGGG + Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1192563550 X:72143694-72143716 CACTCTGGACAGCAGGAGAGAGG + Intergenic
1193352333 X:80477946-80477968 CAGGCTGGACAGGGTCAAGGTGG - Intergenic
1194531587 X:95055710-95055732 CTGGCTGGGCAGCAGGGATGGGG - Intergenic
1194714969 X:97277541-97277563 CAGTCTGTACAGCTGGAATGTGG - Intronic
1195852341 X:109296539-109296561 CAAGCTGGAGAGGAGTAAGGAGG + Intergenic
1196238251 X:113308133-113308155 CAGGAAGGATAGCAGGGAGGAGG + Intergenic
1196653880 X:118196966-118196988 CAGGCTGGAAGGAAGGAAAGAGG + Intergenic
1196731205 X:118943203-118943225 GAGCCAGGAAAGCAGGAAGGAGG + Intergenic
1197148073 X:123190589-123190611 CAGGGGGGACAGCAGCAAGAAGG + Intronic
1197727409 X:129785698-129785720 GAGGCTGGAAAGCAAGCAGGAGG - Intronic
1200063990 X:153496148-153496170 CAGCCAGGACAGCAGGAGAGAGG - Intronic
1200933220 Y:8715766-8715788 CTGGCTGGAGAGCAGACAGGAGG - Intergenic
1200957525 Y:8967103-8967125 GAGGAAGGACAGAAGGAAGGAGG - Intergenic
1201579039 Y:15492075-15492097 CAGGCAGGAGAGCAGGAAGGTGG + Intergenic
1202193058 Y:22264147-22264169 CAGCCAGGACAGCAGGAATCTGG - Intergenic