ID: 1175728774

View in Genome Browser
Species Human (GRCh38)
Location 20:61337857-61337879
Sequence CAGAATTACCAGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175728774_1175728777 1 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728777 20:61337881-61337903 GATGTGTGAGTTTCTGCCCTGGG 0: 1
1: 1
2: 1
3: 25
4: 209
1175728774_1175728776 0 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728776 20:61337880-61337902 AGATGTGTGAGTTTCTGCCCTGG 0: 1
1: 2
2: 0
3: 13
4: 215
1175728774_1175728778 2 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728778 20:61337882-61337904 ATGTGTGAGTTTCTGCCCTGGGG 0: 1
1: 1
2: 2
3: 23
4: 225
1175728774_1175728783 28 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728783 20:61337908-61337930 TTAGTTTTCTCAAACTGCAGGGG 0: 1
1: 0
2: 2
3: 22
4: 219
1175728774_1175728781 26 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728781 20:61337906-61337928 TTTTAGTTTTCTCAAACTGCAGG 0: 1
1: 0
2: 1
3: 24
4: 366
1175728774_1175728784 29 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728784 20:61337909-61337931 TAGTTTTCTCAAACTGCAGGGGG 0: 1
1: 0
2: 1
3: 8
4: 182
1175728774_1175728782 27 Left 1175728774 20:61337857-61337879 CCTTCTTTCCTCTGGTAATTCTG 0: 1
1: 1
2: 2
3: 18
4: 334
Right 1175728782 20:61337907-61337929 TTTAGTTTTCTCAAACTGCAGGG 0: 1
1: 0
2: 2
3: 19
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175728774 Original CRISPR CAGAATTACCAGAGGAAAGA AGG (reversed) Intronic
902147781 1:14418102-14418124 CAGAGTTACCAGTGGAACCACGG + Intergenic
903431766 1:23309065-23309087 CAGAATTTCTAAAGGAAATAGGG + Intronic
904134941 1:28304827-28304849 CAGAATTACCAGTGTAAAGGAGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905916572 1:41688740-41688762 CAGAATGATCAGAGGAGAGGTGG - Intronic
906281370 1:44556454-44556476 CAGGTTTACCAGAGGACAGCAGG - Intronic
907509639 1:54948631-54948653 GAGAAAGAACAGAGGAAAGAAGG - Intergenic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908712829 1:67036820-67036842 CAGAACTACCAGAACAAAGTGGG - Intronic
908756757 1:67475851-67475873 CAGAATAAACTGGGGAAAGAAGG + Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
914017649 1:143835171-143835193 AAAAATTACCACAAGAAAGAAGG - Intergenic
914656259 1:149743703-149743725 AAAAATTACCACAAGAAAGAAGG - Intergenic
915671413 1:157491893-157491915 CAGAAGGTCCAGGGGAAAGAAGG - Intergenic
915757297 1:158275092-158275114 CAGCACTACCAAAAGAAAGAGGG + Intergenic
915804789 1:158834570-158834592 CACAATTAACAGAGTAAAAAAGG - Intronic
915968972 1:160338971-160338993 CAAAATCACCAGAGACAAGATGG + Intronic
916029342 1:160862672-160862694 CAGCATTTCCACAGGACAGAGGG + Exonic
916604855 1:166330979-166331001 CAGAAAGGCCAGAGGAATGAAGG + Intergenic
917360604 1:174171643-174171665 CACAGTTACCAGGGGAAAGGAGG - Intronic
917475016 1:175362009-175362031 CATAATGACCAGAGGAAGGGAGG - Intronic
918370615 1:183857716-183857738 CATAATTACCTGAGGGAAAATGG + Intronic
918563413 1:185896998-185897020 CAGAATTACAAAAGGAAAGTTGG - Intronic
919294224 1:195673871-195673893 CAGAATTTTCAAAGGAATGAAGG + Intergenic
919687050 1:200493514-200493536 CAGAAATTCCACAGGAAAGGAGG + Intergenic
920051702 1:203168277-203168299 CAGAACCACCAGGGGAAGGAAGG + Intronic
920689303 1:208133802-208133824 CTGAATTACCAGAAGAATCAGGG - Intronic
921102387 1:211940632-211940654 CAGAATTAAAATAGGAAAAAAGG + Exonic
921338916 1:214114861-214114883 CAGAATGACCAGTTGAAAGCTGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922137286 1:222841898-222841920 CTGAAATATCAGAGGAAAAATGG + Intergenic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923935932 1:238760218-238760240 CAGAAATACCTGAGGAAAAAAGG - Intergenic
1064075576 10:12265980-12266002 CACAACTTCCAGAGGAAAGGGGG + Intergenic
1065283061 10:24160074-24160096 TGGAATTAACAGAGAAAAGATGG - Intronic
1066052056 10:31645021-31645043 GAGAATGCCCAGAGGAAAGGAGG + Intergenic
1067671682 10:48329227-48329249 CTTAACTAGCAGAGGAAAGAGGG - Intronic
1068336329 10:55636726-55636748 CGGAATTACTAGGGGAAAGATGG - Intergenic
1070532191 10:77346757-77346779 CAGAATTACCAGACCCAAGATGG + Intronic
1071820904 10:89279704-89279726 CAGAATTGACAGTGGAAGGAGGG + Intronic
1072045515 10:91650899-91650921 CAGAATAACCAGAAGCTAGAAGG - Intergenic
1072826931 10:98616266-98616288 CAGAACTGACAGAGGAAAGGTGG - Intronic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074604758 10:114950334-114950356 CAGAATTATAAGAGTAAACAAGG - Intronic
1074628092 10:115216855-115216877 CAAAATTACCAAAAGAAAAAAGG - Intronic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1076635172 10:131876861-131876883 CAGAATTAACAGTGGAAACGTGG - Intergenic
1076864245 10:133159604-133159626 CAGAACTCCCACAGGAGAGAGGG - Intergenic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1078713519 11:13817609-13817631 CAAGATCACCAGAGGAGAGAAGG + Intergenic
1078797257 11:14604716-14604738 GGGAATTACCAGAGGAAGGAGGG - Intronic
1079707992 11:23645986-23646008 CAGAATGACAAGAGCAAAGTTGG + Intergenic
1080310355 11:30883214-30883236 CTGAATGACAAGAGGAGAGAAGG + Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1084851125 11:71941813-71941835 CATAATTAGCAAAGGAAAAATGG + Intronic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086178248 11:83918419-83918441 AAGAATTACCACAGGAAGAATGG - Intronic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1086783327 11:90934297-90934319 CATAACTAAGAGAGGAAAGATGG + Intergenic
1090739749 11:129647160-129647182 CAAAATTATCAGAGATAAGAGGG + Intergenic
1090961154 11:131558177-131558199 AAGAACTTCCAAAGGAAAGAAGG - Intronic
1095190875 12:39256668-39256690 CAGAAATACCAGAATGAAGAGGG - Intergenic
1095398238 12:41785770-41785792 AAGAATTAAAAGAGGCAAGAGGG - Intergenic
1095591986 12:43914038-43914060 CAGATGCACCAGAGGAAATATGG - Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096627444 12:52904325-52904347 CAGAATGACCTGAGGAAGAACGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097162199 12:57055075-57055097 AAGGATTCCCAGAGCAAAGAAGG + Intergenic
1097691678 12:62739853-62739875 TAGATTTTACAGAGGAAAGAGGG + Intronic
1098168863 12:67725422-67725444 CAGAATTACCAAAAGAAAACTGG + Intergenic
1098665509 12:73157664-73157686 CAAAAGTAGCAAAGGAAAGAAGG - Intergenic
1101452918 12:104796814-104796836 TAAAATAACCAGAGGAGAGATGG - Intergenic
1102239039 12:111312309-111312331 CAGAACCACCAGAGGCCAGAGGG + Intronic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1102781285 12:115567201-115567223 CAGAAATATGAGAAGAAAGATGG + Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105401894 13:20103708-20103730 CCGATATACCAGAGGAAAGGTGG - Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1107340222 13:39397581-39397603 CTGAGATGCCAGAGGAAAGAGGG - Intronic
1108674200 13:52722154-52722176 GAGAATGACCAGAGCAAGGAAGG + Intronic
1109118698 13:58425813-58425835 CCAAATTCCCAGAGGACAGACGG - Intergenic
1109299638 13:60577635-60577657 AAGAAATACCAAAGAAAAGAAGG + Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109589282 13:64456543-64456565 GCAAATTACCAGAGGAAAAAAGG + Intergenic
1110924741 13:81137452-81137474 CAGCATTATCAAGGGAAAGAAGG + Intergenic
1112683230 13:101791419-101791441 GAGAAATTCCAGAGGAAATAAGG - Intronic
1113668422 13:112157949-112157971 CCAAATTAACAGAGGAAAAATGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114039985 14:18668813-18668835 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1114045019 14:18867336-18867358 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1114119191 14:19652132-19652154 CTTAATCACCAGAGAAAAGAGGG + Intergenic
1114261856 14:21042763-21042785 CAGAAATACAAGATGAGAGATGG + Intronic
1115308070 14:31952250-31952272 AGTCATTACCAGAGGAAAGAAGG + Intergenic
1116321668 14:43474711-43474733 TTGAAATACCAGAGGCAAGATGG + Intergenic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1116981001 14:51170248-51170270 AGGAAATACCAGAGGACAGAGGG - Intergenic
1118180025 14:63483442-63483464 CAGAATCACAAGAGGAAGAAGGG + Intronic
1119914787 14:78387778-78387800 CATTATCACCATAGGAAAGAAGG - Intronic
1121421357 14:93817997-93818019 CAGAGTTACCAGCAGAGAGAGGG - Intergenic
1121505281 14:94472427-94472449 CAGAAGTGCCAGAAGAGAGAAGG - Intronic
1124149042 15:27160269-27160291 CAGACTGACCTAAGGAAAGATGG - Intronic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126617463 15:50599705-50599727 TACAATTACCAGAGGCAACATGG - Intronic
1127807619 15:62535492-62535514 CAGAATTACCTGGAGAGAGAGGG - Intronic
1128679546 15:69638039-69638061 CAGCATGACAAGAGGAGAGAGGG - Intergenic
1128853263 15:70984236-70984258 CTGCATTCCCAGAGGAAACAGGG + Exonic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1130574466 15:85079509-85079531 CAAAATAACAAGAGGAAATAGGG + Intronic
1130664260 15:85855959-85855981 CAGAAGCAAGAGAGGAAAGAGGG - Intergenic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1133604569 16:7373607-7373629 CAGAAATGACAGAGGAAACAGGG + Intronic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134313630 16:13098484-13098506 CAGAAATTCCAAAGGCAAGAGGG - Intronic
1136002662 16:27306761-27306783 CTGATTTGCCAGAGGTAAGAGGG + Intergenic
1138209161 16:55148537-55148559 CAGAATCTCCAGGTGAAAGAAGG + Intergenic
1139296088 16:65902143-65902165 CAGAATTTCCAAAGTACAGAGGG + Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144758827 17:17695503-17695525 GAGAAAGACCAGGGGAAAGAAGG - Intronic
1145820447 17:27829825-27829847 CAAAAGTACCAGAAGAGAGAAGG + Intronic
1145821494 17:27839998-27840020 CAAAAGTACCAGAAGAGAGAAGG - Intronic
1146987402 17:37233296-37233318 CAGAATTCTCAGAGGAAATATGG + Intronic
1147840977 17:43371238-43371260 GAGAGTTACCAGAGGTAAGGAGG + Intergenic
1149367701 17:55962462-55962484 CAAAGTTACCAGAGGATACAAGG - Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149828688 17:59852171-59852193 CAGAAGTACCAGAGTTCAGAGGG + Intergenic
1150040315 17:61853307-61853329 AAGAATTACCTATGGAAAGAAGG + Intronic
1150847392 17:68673403-68673425 CAGAAATTCCAGAGGACACAGGG - Intergenic
1151194824 17:72424015-72424037 GAGAAAGACAAGAGGAAAGACGG + Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155724714 18:29066197-29066219 CCTAATTACCTTAGGAAAGAAGG - Intergenic
1156759241 18:40567458-40567480 AACAATTACTAGAGGAAAGTAGG + Intergenic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1158283244 18:55850850-55850872 GAGAATTGACAGAGCAAAGAGGG + Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159095378 18:63895707-63895729 AAGGATTTCCAGAGGAGAGAGGG + Intronic
1159807541 18:72974343-72974365 CAGAATGAGCAGGGGAAAGCCGG - Intergenic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1166298241 19:41899447-41899469 CACAATTAGCAAAGGAAAAAAGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
925261774 2:2535578-2535600 CAAAATTACAAGAAGAAAGTAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926457315 2:13082858-13082880 CAAAATTTAAAGAGGAAAGAAGG - Intergenic
926775377 2:16416967-16416989 CAGAATTACCAAGGGAAGGAGGG + Intergenic
927063566 2:19446904-19446926 GAGGAATCCCAGAGGAAAGAAGG + Intergenic
927350725 2:22110481-22110503 AATAATTACCAGAGTAAAGGAGG + Intergenic
929019595 2:37538497-37538519 CAAAACCACCAGAGAAAAGATGG - Intergenic
929345114 2:40872796-40872818 CAGTATCACCAGGGGACAGAAGG - Intergenic
930105822 2:47638556-47638578 CAGAATTACAAGAAATAAGATGG - Intergenic
930122534 2:47771576-47771598 CAAAATTACAGGAAGAAAGAAGG + Intronic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
933172055 2:79135580-79135602 CAAATTTAGCAGAGGAGAGATGG + Intergenic
933523065 2:83399270-83399292 GAGTACTACCAGAGGAAAAAAGG + Intergenic
933986080 2:87593403-87593425 CAGAATTTGCAGAGGTCAGAGGG + Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
935445290 2:103149867-103149889 GAAAAATACCAGAGCAAAGAGGG + Intergenic
935534644 2:104279883-104279905 CAGATTTGGAAGAGGAAAGAGGG - Intergenic
936097600 2:109544284-109544306 CAGAAGTTCCAGAGCACAGAAGG - Exonic
936307757 2:111357400-111357422 CAGAATTTGCAGAGGTCAGAGGG - Intergenic
936667145 2:114609836-114609858 CTGAGTTACCAGAGGACAGTGGG + Intronic
936857972 2:116982815-116982837 TAGAATAACCAGTGCAAAGAAGG + Intergenic
937827606 2:126383935-126383957 CAGAATTGCTAGAGGATAAAAGG + Intergenic
938085525 2:128397778-128397800 CAAAAGCAACAGAGGAAAGATGG - Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939616831 2:144371005-144371027 CAGAATTAGAAGTGGAAATAAGG + Intergenic
940579105 2:155553522-155553544 TAGCATTTCCTGAGGAAAGAGGG + Intergenic
941886514 2:170533378-170533400 CAGAATTAAAAGAGGAAAACTGG + Intronic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
942191103 2:173471336-173471358 GAGAATTATCATAGGAAACAAGG + Intergenic
943748054 2:191482911-191482933 CTGAGCTACAAGAGGAAAGATGG + Intergenic
943826473 2:192400194-192400216 CAGCATTCCCAAAAGAAAGAAGG + Intergenic
944214124 2:197236914-197236936 CAGAAATATTAGAGGAAAAATGG + Intronic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948079710 2:235195744-235195766 AAGATTCACCTGAGGAAAGAGGG - Intergenic
948392238 2:237620639-237620661 TAAAATAACCATAGGAAAGATGG - Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1173209678 20:41022439-41022461 CAGTATTCCCTGAGGAATGAAGG - Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1175022746 20:55868314-55868336 CAGAAAAACCAGGGGAAAAAAGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1177152911 21:17472576-17472598 CGGAGTTCCCAGAGGATAGAAGG - Intergenic
1177154913 21:17491774-17491796 CAGAATCACCAGGTGAAAAATGG - Intergenic
1177390966 21:20471461-20471483 TAGAATTATCAGGGGAGAGAGGG + Intergenic
1177611946 21:23461409-23461431 CAAAATTACCAGAGGCAAAGAGG - Intergenic
1178067702 21:28924482-28924504 AAGAATTACCAGATGCAAAATGG + Intergenic
1178721895 21:35017721-35017743 CAGAACTATGAGAAGAAAGATGG - Intronic
1179030401 21:37714975-37714997 CAGAGGTACGTGAGGAAAGACGG - Exonic
1180463551 22:15589950-15589972 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1180592452 22:16952759-16952781 CAGAATTGCAAGAAAAAAGAGGG + Intergenic
1182790736 22:32950754-32950776 CAGATTTAGCAGAGGAACTAAGG + Intronic
1182857134 22:33527750-33527772 CATAATAACAAAAGGAAAGAAGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1185078728 22:48697237-48697259 TAGAATTGCCATAGGAATGAGGG + Intronic
1185096389 22:48808363-48808385 AAGAATTCCCAGAGGAGAGAGGG - Intronic
949337824 3:2995415-2995437 CAGCATTACAAAAGGAGAGAAGG - Intronic
950478609 3:13230194-13230216 CATTATTACCCGAAGAAAGATGG + Intergenic
951736431 3:25870378-25870400 CAAAATTACCAAAGGAATGTCGG + Intronic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
955129915 3:56156171-56156193 AAGAATCACCAAAAGAAAGAGGG + Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
957736839 3:84214550-84214572 CAAAAATAGCACAGGAAAGATGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
962126344 3:132623834-132623856 CAGAATTGGCAGAGGAAACCAGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962379335 3:134884676-134884698 CAGAATAACCAAAGGAAATGTGG - Intronic
962418643 3:135207540-135207562 CATAATTACCAGCTGAAATAAGG + Intronic
963141933 3:141953432-141953454 CAGAAATACATGAGGTAAGAAGG + Intronic
963510459 3:146241410-146241432 GAAAATTACCAGAGATAAGAAGG + Intronic
964159274 3:153627187-153627209 CAAAATTAGAAGAGGAAATAAGG - Intergenic
965785074 3:172326976-172326998 CAGAAATAGAGGAGGAAAGAAGG + Intronic
966618002 3:181932912-181932934 CAGAATTACATGGGGACAGAAGG - Intergenic
966748743 3:183302484-183302506 AAGACTAACTAGAGGAAAGAGGG + Intronic
967993149 3:195146636-195146658 GAGACTTTTCAGAGGAAAGAAGG + Intronic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
970269928 4:14335152-14335174 AGGAAATACAAGAGGAAAGAGGG + Intergenic
971144426 4:23961641-23961663 CCCAATTACCACAGGGAAGAGGG - Intergenic
971144445 4:23961721-23961743 CCCAATTACCACAGGGAAGAGGG - Intergenic
971779312 4:31010957-31010979 CAGATTTATCGGGGGAAAGAAGG - Intronic
972333872 4:38088125-38088147 CAGAATTCCAAGAGCCAAGATGG + Intronic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
975481619 4:74887043-74887065 CAGAATTAACAGTGTAAAAATGG + Intergenic
979648806 4:123106680-123106702 CAGAACTACCTCAGCAAAGAAGG + Intronic
980952371 4:139394270-139394292 CAGAAAGATCAGAGGACAGAGGG + Intronic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982501047 4:156155166-156155188 CAGAAACACCAGAGGGCAGAAGG + Intergenic
982614897 4:157628422-157628444 CAGAATAACTAGAGGAATAACGG - Intergenic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
985270308 4:188188096-188188118 AAAAATTAACAGAGGAAAGTGGG - Intergenic
986057926 5:4157592-4157614 CAAATATACCAGAGCAAAGAAGG - Intergenic
986886889 5:12249675-12249697 CAGAATTTCAGGAGGAATGAAGG - Intergenic
990119116 5:52427417-52427439 CATAATTACCAGAGGATGAAGGG + Intergenic
990279126 5:54231046-54231068 CAGAAAGAGCAGGGGAAAGAGGG - Intronic
990843706 5:60112887-60112909 CAAAATTTCCAGAAGAGAGAAGG + Intronic
991206095 5:64051637-64051659 GAGAAATCCCAGAGGAGAGAAGG + Intergenic
991336887 5:65558796-65558818 CATAATCACTAGGGGAAAGAAGG + Intronic
991659609 5:68936917-68936939 CAGAAGACCCAGAGGAAAGCAGG + Intergenic
993268394 5:85760644-85760666 AGAAATTAGCAGAGGAAAGAAGG + Intergenic
993678180 5:90842800-90842822 GAAAATAACCAGAGCAAAGAAGG - Intronic
994473851 5:100242350-100242372 CTGAATTAGCACAGTAAAGATGG + Intergenic
995790190 5:115878480-115878502 CAGATTTACCAAAGGTCAGATGG + Intronic
996009639 5:118467672-118467694 CAGATCTACCAGAGCAAAGCTGG + Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996481528 5:123980900-123980922 CATAAATGCCAGAGGAGAGAGGG - Intergenic
996785584 5:127233339-127233361 CAGAAGTAACAAAGGAGAGAAGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997682271 5:135764983-135765005 CATAATATCCAGAAGAAAGAGGG + Intergenic
1002537607 5:179886136-179886158 CAGGAGTGCCAGGGGAAAGAAGG - Intronic
1002669239 5:180852198-180852220 TGAAATTACCAGAGAAAAGATGG + Intronic
1003182198 6:3801522-3801544 CAGAATGACCAGGGCAGAGAGGG + Intergenic
1003569987 6:7249453-7249475 GTAAATGACCAGAGGAAAGATGG + Exonic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006995894 6:38259701-38259723 CAGAATTACAATAGAAAATAAGG - Intronic
1010850577 6:80771462-80771484 CAGAAACACCATTGGAAAGAGGG - Intergenic
1011268904 6:85555555-85555577 AGGGATTCCCAGAGGAAAGAAGG + Intronic
1013100143 6:106979367-106979389 CAGAATTAAGAGGGAAAAGAGGG - Intergenic
1014206479 6:118661192-118661214 CAGAATTTTCAAAGGAAAAATGG + Intronic
1014346033 6:120270614-120270636 CAGAAATCCCAGAGAATAGAAGG + Intergenic
1016444549 6:144118852-144118874 CCCAAATACCAGAGGAAACAGGG - Intergenic
1016784548 6:147995760-147995782 CAGGACTACCAGAGCAAGGAAGG + Intergenic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1019752439 7:2739967-2739989 CAGAATTACCAAAGGACTGCCGG - Intronic
1019862297 7:3670652-3670674 GAGAATTCCCAGAGACAAGAAGG - Intronic
1020383994 7:7577675-7577697 CACATTTGCCAGAGGAAAGGGGG + Intronic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1021911970 7:25395169-25395191 CAGAATTGCCAGATGAAAATAGG + Intergenic
1022220062 7:28305442-28305464 TAGAATTCCCAGGGGAAAGCTGG - Intronic
1022587658 7:31630194-31630216 CTAAATTACCAGAGGAAAAGAGG + Intronic
1022597721 7:31728575-31728597 CACAAATACCTGAGGAATGAGGG - Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023535305 7:41202627-41202649 CAAAATTACCAGAGTTGAGATGG - Intergenic
1023567407 7:41537283-41537305 CTGAATTTCCATAGGCAAGAGGG - Intergenic
1023634424 7:42195407-42195429 CAGACTTTCCAGAGGTAAAAGGG - Intronic
1024090411 7:45935088-45935110 GAGATCTACCAGAGGAAAAATGG + Intergenic
1026460745 7:70613182-70613204 CAGAATAGCAAGAGGAAAAAAGG + Intronic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1026740150 7:72974114-72974136 CTGAATCAGCAGAGGAGAGAAGG + Intergenic
1026925485 7:74189631-74189653 CAGAATTACTTGAGGAAATCGGG + Intronic
1027103583 7:75390956-75390978 CTGAATCAGCAGAGGAGAGAAGG - Intergenic
1027628332 7:80571662-80571684 TAAAACTACCAGAAGAAAGATGG - Intronic
1029242361 7:99172690-99172712 ATTAATTGCCAGAGGAAAGAAGG + Intergenic
1030141177 7:106305410-106305432 AAAAGTTGCCAGAGGAAAGAGGG + Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1032351343 7:131166623-131166645 AAGAACTGCCCGAGGAAAGAGGG - Intronic
1032567816 7:132966210-132966232 CAGAATTACCAAATGAAGTAAGG - Intronic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1037143271 8:15542391-15542413 CAGAATTCCAAGAAGAAGGAGGG + Intronic
1037895706 8:22652923-22652945 CAACCATACCAGAGGAAAGAGGG - Intronic
1038187720 8:25290904-25290926 CAGAATTACCAGTTGGCAGAGGG + Intronic
1038235517 8:25749681-25749703 CAGAACAGCCAGAGGAAAAAAGG + Intergenic
1041307420 8:56476802-56476824 CAGAAGTTCCAGAGCACAGAAGG - Intergenic
1041395382 8:57384804-57384826 CTGGAATCCCAGAGGAAAGAGGG + Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042396671 8:68299520-68299542 CAGAATTACCAAAGCAAAATAGG + Intergenic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1042782688 8:72509635-72509657 CAGTATTGCCTCAGGAAAGAAGG + Intergenic
1043081935 8:75776859-75776881 CAGAGATACCAAAAGAAAGAAGG - Intergenic
1044625529 8:94232621-94232643 CAGAATTCCCAGAGCAGTGAGGG + Intergenic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1046029679 8:108768644-108768666 CAGACCTACCAGAGGAAGGTGGG - Intronic
1046675056 8:117098728-117098750 CAGTATTACCAAAGAACAGAGGG - Intronic
1046740801 8:117827022-117827044 CTGATTTGCCAGATGAAAGATGG - Intronic
1047093012 8:121594293-121594315 TAGAATTAACAGAAGACAGAGGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047458478 8:125038733-125038755 CAGAAATACCAGAGGAACCTGGG - Intronic
1048492965 8:134911805-134911827 CTGATTTTCCAGAGGAGAGAAGG + Intergenic
1048793529 8:138127503-138127525 CAGAATTGGAAGAGGAAAAATGG - Intergenic
1048879085 8:138858541-138858563 CAGAATCTCCAGGGGAAAGCTGG - Intronic
1050415524 9:5412672-5412694 CAAAAGTACCACAGGAAACAAGG + Intronic
1050572724 9:6958182-6958204 CAGAGTTAACAGGTGAAAGACGG - Intronic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1050879071 9:10676228-10676250 TGGAATTACAAGAAGAAAGAAGG + Intergenic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1053594273 9:39544043-39544065 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1053750580 9:41250506-41250528 GAGAACTACCAGATGAATGAGGG + Intergenic
1053852054 9:42299088-42299110 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1054335221 9:63800763-63800785 GAGAACTACCAGATGAATGAGGG - Intergenic
1054571980 9:66820915-66820937 CTGAATTCCAAGAGGAAAGAGGG + Intergenic
1055070130 9:72157539-72157561 CAGAAATCCCAGAGGAAAATTGG - Intronic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1057170483 9:92960473-92960495 CAGAATAACCATGGGTAAGATGG + Intronic
1057647254 9:96888282-96888304 AAGAATTACTGGAGCAAAGAGGG + Intergenic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059979649 9:119756972-119756994 CAAAATTATCAGAAGAAAGGAGG - Intergenic
1061360354 9:130137930-130137952 CAGATTTCTCAGAGGAAACATGG - Exonic
1061408089 9:130403608-130403630 CAGAATGACCAAGGGACAGAAGG - Intronic
1186052657 X:5615257-5615279 CAGAATTGCCACAGGTGAGAAGG - Intergenic
1187002061 X:15192101-15192123 CTGAGTTAGCAGAGAAAAGAAGG + Intergenic
1188407741 X:29832669-29832691 CAGCATTTACAGAGGAAATAAGG - Intronic
1189756677 X:44278983-44279005 CAGAATTACCTGGGGAGAGTAGG - Intronic
1191607641 X:63079655-63079677 AAGAGATACCATAGGAAAGAAGG - Intergenic
1193150415 X:78118742-78118764 CAGAATTCAGAGAGGAAAGTTGG + Intronic
1195255686 X:103087588-103087610 TACTTTTACCAGAGGAAAGATGG + Intronic
1195701640 X:107710157-107710179 CAGAAAGACCATAGGAAAAAAGG - Intergenic
1196378773 X:115066594-115066616 CAGAAATATGAGAGGAGAGAAGG - Intergenic
1198211841 X:134523543-134523565 GAGAATTACCCAAAGAAAGACGG + Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1199767000 X:150948590-150948612 AAAAAAAACCAGAGGAAAGAGGG + Intergenic
1199864940 X:151836315-151836337 CAAAGTTACCAAAGGAAGGATGG + Intergenic
1199927402 X:152481357-152481379 CAGAATTCCCAAAAGAAACAAGG + Intergenic
1200901952 Y:8441680-8441702 TAGAATTACCAAAGGAAGCAGGG + Intergenic
1201057025 Y:10004222-10004244 TAAAATGAGCAGAGGAAAGATGG - Intergenic