ID: 1175730004

View in Genome Browser
Species Human (GRCh38)
Location 20:61347945-61347967
Sequence CTTCCCTTTAACCATGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175730004_1175730015 28 Left 1175730004 20:61347945-61347967 CCCTTTCCATGGTTAAAGGGAAG No data
Right 1175730015 20:61347996-61348018 GAAGACTTTCTTCTGGGAACAGG No data
1175730004_1175730014 22 Left 1175730004 20:61347945-61347967 CCCTTTCCATGGTTAAAGGGAAG No data
Right 1175730014 20:61347990-61348012 ATCGGGGAAGACTTTCTTCTGGG No data
1175730004_1175730008 4 Left 1175730004 20:61347945-61347967 CCCTTTCCATGGTTAAAGGGAAG No data
Right 1175730008 20:61347972-61347994 GAAACCCACGTGTGTATTATCGG No data
1175730004_1175730010 6 Left 1175730004 20:61347945-61347967 CCCTTTCCATGGTTAAAGGGAAG No data
Right 1175730010 20:61347974-61347996 AACCCACGTGTGTATTATCGGGG No data
1175730004_1175730013 21 Left 1175730004 20:61347945-61347967 CCCTTTCCATGGTTAAAGGGAAG No data
Right 1175730013 20:61347989-61348011 TATCGGGGAAGACTTTCTTCTGG No data
1175730004_1175730009 5 Left 1175730004 20:61347945-61347967 CCCTTTCCATGGTTAAAGGGAAG No data
Right 1175730009 20:61347973-61347995 AAACCCACGTGTGTATTATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175730004 Original CRISPR CTTCCCTTTAACCATGGAAA GGG (reversed) Intronic