ID: 1175730561

View in Genome Browser
Species Human (GRCh38)
Location 20:61350956-61350978
Sequence GCCTGGTTCCTGCTTCAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175730561_1175730570 28 Left 1175730561 20:61350956-61350978 CCGGTCTGAAGCAGGAACCAGGC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1175730570 20:61351007-61351029 CTGTGTTCACGGTGGTGCTGGGG 0: 1
1: 0
2: 5
3: 19
4: 202
1175730561_1175730564 17 Left 1175730561 20:61350956-61350978 CCGGTCTGAAGCAGGAACCAGGC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1175730564 20:61350996-61351018 CGCCAACAAACCTGTGTTCACGG 0: 1
1: 0
2: 0
3: 3
4: 70
1175730561_1175730567 26 Left 1175730561 20:61350956-61350978 CCGGTCTGAAGCAGGAACCAGGC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1175730567 20:61351005-61351027 ACCTGTGTTCACGGTGGTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 142
1175730561_1175730566 20 Left 1175730561 20:61350956-61350978 CCGGTCTGAAGCAGGAACCAGGC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1175730566 20:61350999-61351021 CAACAAACCTGTGTTCACGGTGG 0: 1
1: 0
2: 0
3: 13
4: 127
1175730561_1175730569 27 Left 1175730561 20:61350956-61350978 CCGGTCTGAAGCAGGAACCAGGC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1175730569 20:61351006-61351028 CCTGTGTTCACGGTGGTGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175730561 Original CRISPR GCCTGGTTCCTGCTTCAGAC CGG (reversed) Intronic
900410210 1:2509198-2509220 GCCTGGTAGCTGCCTCAGCCTGG + Intronic
900623795 1:3599049-3599071 GCCTGCTGCCTGCCTCAGGCAGG - Intronic
904032688 1:27543106-27543128 AACTGCTTCCTGCTTCAGTCAGG + Intronic
904750711 1:32740341-32740363 GGCTGGTTCCTGATCCAGAATGG + Intergenic
905253146 1:36662750-36662772 GCCTGGCTCCTGCCTCAGGCTGG - Intergenic
907550534 1:55301191-55301213 GCCTGGTTCCTGCCTCTCTCCGG + Intergenic
907924751 1:58944742-58944764 GCCTCCTTGCTGCTTCAGAAAGG - Intergenic
909562494 1:77022197-77022219 GCAAGGTTTCTGCTTCAGAGAGG - Intronic
909589895 1:77335902-77335924 GCCTGCTTCCTGGTTCATAGCGG + Intronic
910304449 1:85746725-85746747 GCCAGGTTGCTGCTTCTGCCTGG - Intronic
912500645 1:110119943-110119965 TCCTGATTCCTGCTCCAGCCTGG + Intergenic
915527411 1:156484625-156484647 GCCTGGTGCCTGCATCCGCCTGG - Intronic
916051399 1:161039104-161039126 TCCTGGTTCCTGGGCCAGACCGG - Intergenic
917896142 1:179489684-179489706 TCCTGCTTCTTGATTCAGACAGG - Intronic
918388643 1:184036564-184036586 GCCGGGCTCCTGCTCCAGGCTGG - Intronic
919583969 1:199412849-199412871 TCCTCTTTCATGCTTCAGACTGG - Intergenic
920710157 1:208287289-208287311 GCCGGGTTACTGCTTCACAGAGG - Intergenic
922361277 1:224823885-224823907 GCTAGGTACCTGCTTCAGTCAGG - Intergenic
922767286 1:228162731-228162753 CCCTGGCCCCTGCTTCAGCCTGG + Intergenic
1063295285 10:4799104-4799126 ACCAAGTTCCTCCTTCAGACTGG - Intronic
1065555113 10:26907343-26907365 GAGTGGTCCCTGCTGCAGACTGG - Intergenic
1066057598 10:31696514-31696536 TCCTCGTTCCTCCTTCACACCGG + Intergenic
1066184527 10:32996112-32996134 TCCTGGTTCCTGTTTCAGAAAGG - Intronic
1067284663 10:44898886-44898908 GCCTGGCTCCTGGCTCAGACAGG - Intergenic
1067348922 10:45458034-45458056 GCCTGGGTCCTGCCTCTGCCTGG - Exonic
1069633668 10:69912668-69912690 GCCTGGTTTCTGCTGCAGCCAGG - Intronic
1069684438 10:70308642-70308664 ACATGGTTCCTGCTCCAGGCAGG - Intronic
1076290918 10:129344654-129344676 TCCGGGTCACTGCTTCAGACTGG - Intergenic
1076541202 10:131216054-131216076 GCCTTGTCCCTGCATCAGCCTGG + Intronic
1076765822 10:132632502-132632524 GCCTGGTTCCTGCCTCTCAGAGG - Intronic
1077551118 11:3200750-3200772 GCCTGGTTCCTGCCTCTGCCAGG - Intergenic
1079858139 11:25631779-25631801 GGCTGGCTGCTGCTTCACACAGG - Intergenic
1080773798 11:35366825-35366847 CCCTGGCTGCTGCTTCAGCCCGG + Intronic
1083158858 11:60842333-60842355 GCCTGCACCCTGCTGCAGACGGG - Exonic
1083305821 11:61761486-61761508 GTCTGGTTCCTGTTCCAGGCAGG + Intronic
1085055004 11:73398294-73398316 GCCCTGTGCCTGCTGCAGACAGG - Intergenic
1085287063 11:75369952-75369974 GCCTGGTGCCACCTTGAGACAGG - Intergenic
1087024732 11:93638485-93638507 GGCTGGTTCCTAGTGCAGACTGG + Intergenic
1087064221 11:94012031-94012053 GCCTGCTTCATGCTGCAGAGTGG - Intergenic
1087647470 11:100825275-100825297 GCCTTGTTCCTGATTCAGTTGGG + Intronic
1087818470 11:102685002-102685024 GCCTGCTTCCAGCTTCTGGCTGG + Intergenic
1088755286 11:112880627-112880649 GACTGGTTCCTGCACCGGACAGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1093721359 12:22446093-22446115 GCGTGGTTCCTTATTCAGCCTGG + Intergenic
1095188038 12:39224675-39224697 GGCTGGTTTGTGCTTCAGGCAGG + Intergenic
1095632835 12:44398367-44398389 GAATGCTTCCTGCTTCAAACTGG - Intergenic
1098448539 12:70592807-70592829 GCCTGGATTCTGGTTCAGACTGG + Intronic
1099501077 12:83415108-83415130 GCCTGGTTGCTCCTGCAGAAGGG - Intergenic
1103936896 12:124481734-124481756 GGCTTTTTCCTGCTTGAGACAGG + Intronic
1104230172 12:126877014-126877036 GCCTCACTCCTGCTTTAGACTGG + Intergenic
1107256360 13:38432237-38432259 CTCTGGTTCCTGTTTCAAACTGG + Intergenic
1112766612 13:102752388-102752410 GCCTGTTTCTGGCTTCTGACAGG + Intronic
1113604543 13:111595976-111595998 GCCTGGCTCCTGCTTCCTAAAGG - Intronic
1113618352 13:111696612-111696634 GCCTGACCCCTGCCTCAGACTGG + Intergenic
1113623883 13:111781873-111781895 GCCTGACCCCTGCGTCAGACTGG + Intergenic
1115790410 14:36871298-36871320 GCCTGTTTCCTGGTTCATAAAGG - Intronic
1117738138 14:58788256-58788278 GCATGGCTCATGCTTGAGACTGG + Intergenic
1119482241 14:74965313-74965335 TCCTCGTTCCTGCTTCAAACTGG - Intergenic
1119749976 14:77070293-77070315 GCCTAGCTCCTGCTCCAGAATGG - Intergenic
1122509015 14:102250768-102250790 GCCTGGTTCCTGCGGCGGAGCGG - Intronic
1123759763 15:23423150-23423172 GCCAGGTTCCTGCTGCAGCCTGG - Intergenic
1124402559 15:29362236-29362258 CCCTGATTGCTGCTTCTGACTGG - Intronic
1125379786 15:39075469-39075491 GTCTGGCTCCTTCTTCAGAAAGG - Intergenic
1128302453 15:66575093-66575115 GCCTGGGTCCTTCTTCAGAGAGG + Intergenic
1129409032 15:75338734-75338756 GCCTGGTGCCTGGTACAGAGGGG + Intronic
1129468840 15:75738927-75738949 CCCTGGTACCTGCGTCCGACCGG + Intergenic
1130351879 15:83099912-83099934 CCCTGGTTTCTTCTTCAGAGAGG + Intergenic
1130837357 15:87663933-87663955 GCCTCCTTCCTTCTCCAGACTGG + Intergenic
1131746687 15:95456212-95456234 GCATGGTTCCTGCTTGTGTCAGG + Intergenic
1132113461 15:99118963-99118985 GCCTGGTGCCAGCTGCAGGCAGG - Intronic
1132574421 16:657970-657992 GCCTGGGTCCTGCTCCCGAGTGG - Intronic
1133779063 16:8922621-8922643 CCCTGGTTCCAACTGCAGACAGG + Intronic
1134456577 16:14399745-14399767 GCCAGGTTCCTGTTGCAGCCTGG + Intergenic
1134861736 16:17566262-17566284 GCCTGCTTCCTGCCTCAACCTGG + Intergenic
1136369128 16:29825071-29825093 ACCTGGTTTCTGCTTTGGACAGG + Intronic
1137691318 16:50430027-50430049 GACTGGTACCTGCTTCTGAAAGG + Intergenic
1138182921 16:54954937-54954959 GCCTCATTCATGCTTCAGCCTGG + Intergenic
1138561314 16:57802373-57802395 GCCTGGATCCTGCCTCCGCCAGG - Exonic
1138731980 16:59205504-59205526 CCGTGGTTCCTGCTGCAGCCAGG - Intergenic
1140293775 16:73688542-73688564 GCCTGCTTTCTGCTTCATACAGG - Intergenic
1143544432 17:7588121-7588143 GGCTGGTTCCTGCTGCAGTGAGG + Exonic
1144585935 17:16487806-16487828 TCCTGGTTCCTGCTGCTGTCTGG - Intronic
1144713009 17:17414754-17414776 GCCTGGGTTCTGGTTCACACTGG - Intergenic
1146646504 17:34580338-34580360 GCCTGGGCCCTGATCCAGACTGG + Intergenic
1146903331 17:36602018-36602040 GCCCGGCTCCTGCTCCAGGCGGG + Exonic
1147215788 17:38898326-38898348 GACTGGTTGCTGCCTCAGAGGGG + Intronic
1147494816 17:40905538-40905560 GCCTCGTTCCCACTTCAGCCGGG - Intergenic
1148110058 17:45139286-45139308 GCATGGCTCCTGCTACAGGCAGG + Intronic
1148806217 17:50265332-50265354 GGCTGGTGCCTGCCTCAGGCTGG - Intergenic
1150620826 17:66806665-66806687 GCCTGCTGCCTGCTTTAAACAGG - Exonic
1151235198 17:72714845-72714867 GCCACGTTCCTTCTTCAGCCAGG - Intronic
1152749303 17:82055294-82055316 GGCTGGTCCCTGCCTCAGCCAGG + Intronic
1157036008 18:43975085-43975107 ACCTGGTGCTTGCTTCAGGCAGG - Intergenic
1158516194 18:58132049-58132071 GCTTAATTCCTGCTTCAGAAAGG - Intronic
1160339382 18:78074665-78074687 GCTTCCTTCCTGCTTCAGGCCGG + Intergenic
1161218151 19:3105020-3105042 CCCAGGTTCCTGCCTCAGACTGG - Intronic
1161719640 19:5895748-5895770 GTCTGGCTCATGCTCCAGACGGG + Intronic
1164613207 19:29647481-29647503 GCCTGGAGTCTGCCTCAGACAGG - Intergenic
1164681055 19:30133996-30134018 GCCTGGTTCCTGCCTGCCACAGG - Intergenic
1164760258 19:30723121-30723143 TCCTGGTTCCTGCCTCCGCCTGG - Intergenic
1166673291 19:44724283-44724305 CCCTGGCTCCCACTTCAGACAGG + Intergenic
1167337993 19:48898344-48898366 GCCTGTTTCCAGCTTCCCACGGG + Intronic
1168455725 19:56506940-56506962 GGCTGGTGTCTGCTGCAGACAGG + Intergenic
1168717968 19:58540111-58540133 CCCTGCTTCCTTCCTCAGACAGG + Intergenic
1168718206 19:58541079-58541101 CCCTGCTTCCTTCCTCAGACAGG + Intergenic
925466264 2:4109246-4109268 GCCTGCGTCCTGCGTCAGAAAGG - Intergenic
926353888 2:12022211-12022233 GCCTGATTCCTGCTGCCCACAGG + Intergenic
927148754 2:20183894-20183916 GCCTTGTTCCTGCATCCGAAGGG - Intergenic
927255318 2:21036203-21036225 ACCTGGCTCCTGCATTAGACTGG + Intronic
928669121 2:33582377-33582399 GCCTTGTTCCTGCAAAAGACAGG - Intergenic
933691922 2:85185505-85185527 GGCTGGCTCCTGCTTGAGACTGG - Intronic
936487835 2:112942048-112942070 TCCTGGGTCCTGCTACAGAGAGG - Intergenic
937429300 2:121825115-121825137 GGCTGCTTCCTGCAACAGACAGG - Intergenic
939836399 2:147134689-147134711 TTCTGGTTCCTGCTCCAGCCAGG + Intergenic
942643187 2:178082507-178082529 GTCTGTTTCCAGCTTCTGACTGG - Intronic
946028369 2:216686275-216686297 GTCTGGTTCCTGATTCTGAATGG - Intronic
947994951 2:234519468-234519490 GCCTGTTTCCTGGTTCACAGAGG + Intergenic
948034818 2:234849649-234849671 GCCTGGTTCCTGCCTCTGTGAGG - Intergenic
948309387 2:236973715-236973737 GCCTGTTTCCAGCTTCTGGCCGG + Intergenic
948500443 2:238389173-238389195 CCCTGGATCCTGCTTCCGAGAGG + Intronic
948654975 2:239470946-239470968 GCCTAGCTTCTGCTGCAGACAGG + Intergenic
948706717 2:239798532-239798554 GCCTGGTTCCTGCCACACAGCGG + Intronic
948789405 2:240369602-240369624 GTCTGGTTCCAACTTCAAACAGG - Intergenic
948860696 2:240751316-240751338 CCCTGCTTCCTGCTCCAGGCAGG + Intronic
948992893 2:241563729-241563751 GCCTGGCTCCTGCTGCTGTCAGG - Intronic
1168845221 20:939963-939985 GGATGGTTCCTGCTTCAGATGGG - Intergenic
1169814751 20:9644781-9644803 GCCTGGTCTTGGCTTCAGACTGG - Intronic
1171233950 20:23509538-23509560 GCCTGCCTCCCACTTCAGACAGG + Intergenic
1171724498 20:28603404-28603426 CCCTGTTTCCTCCATCAGACAGG - Intergenic
1171858839 20:30376594-30376616 CCCTGTTTCCTCCATCAGACAGG + Intergenic
1172216414 20:33238828-33238850 GCCTGGTTCCTGGATAGGACTGG + Intronic
1172974139 20:38894022-38894044 GAGTGGGTGCTGCTTCAGACGGG - Intronic
1175730561 20:61350956-61350978 GCCTGGTTCCTGCTTCAGACCGG - Intronic
1176146923 20:63569624-63569646 TCCTGGCTCCTGCTTCAGCAGGG + Exonic
1177229389 21:18299895-18299917 TCCTGGTGCCTGCTACAGTCAGG + Intronic
1180298047 22:10962078-10962100 CCCTGTTTCCTCCATCAGACAGG - Intergenic
1180410364 22:12601720-12601742 CCCTGTTTCCTCCATCAGACAGG + Intergenic
1181267109 22:21636799-21636821 GGCTGGTTCCTGCTGCACAGAGG - Exonic
1181844308 22:25694335-25694357 GCATGCTTCCTGCTGCAGCCGGG + Intronic
1182129899 22:27843396-27843418 GCCTGGGTCATGCTGCAGGCAGG + Intergenic
955476662 3:59343354-59343376 GCCTGGATGCTGGTTCAGGCAGG - Intergenic
955972792 3:64452347-64452369 GCCTGGTTAATGCTACAGAAAGG + Intergenic
955992436 3:64642581-64642603 GCCTTCTTCCTGCTCCAGGCTGG - Intronic
968462833 4:733890-733912 TCCTGGTTCCTGCTTTTGTCGGG - Intronic
974793842 4:66723070-66723092 GACTGGTTCCTACTGCAGACTGG - Intergenic
979094444 4:116528708-116528730 GACTGTTTCCTGCTTCATATGGG - Intergenic
981546683 4:145901236-145901258 GCCTACTTCCTGCTCCAGTCTGG + Intronic
985436982 4:189940262-189940284 CCCTGTTTCCTCCATCAGACAGG + Intergenic
991366296 5:65871463-65871485 GCCTGGCTCCTACTTCAAAAAGG - Intronic
1002847172 6:956978-957000 GCCTGGTTCATGGTGCAGCCAGG - Intergenic
1002847683 6:962412-962434 GCATGCTTCCTTCATCAGACTGG + Intergenic
1004179550 6:13369162-13369184 GCTGGGTTCCTGCTGCACACTGG - Intronic
1004455811 6:15790675-15790697 GACTGGTGCCTGTTTCAGACTGG + Intergenic
1006608696 6:35278894-35278916 GCCTGGTTTCTGCGTCACAGTGG - Intronic
1006655956 6:35593153-35593175 CCCTGGTTCCTTCTTCACCCAGG - Intronic
1007750099 6:44066315-44066337 GGCTGTTTCCCGCCTCAGACTGG + Intergenic
1012354151 6:98292117-98292139 TCCTGGTTCCTGCTTCTTTCTGG + Intergenic
1024719273 7:52116876-52116898 TCCTGGTTCCTGCCTCACAGGGG + Intergenic
1029637865 7:101797140-101797162 CCCTGTTTCCTGCAACAGACAGG - Intergenic
1031557104 7:123191137-123191159 TCCTAGTTCCTGGTTCAGATGGG + Intronic
1031851036 7:126864247-126864269 GCCTGGTTGTTCCTTCAGTCTGG + Intronic
1032900867 7:136305830-136305852 ACCTGGTAACTGATTCAGACTGG - Intergenic
1035373486 7:158393543-158393565 GCCCGGCACCTGCTGCAGACCGG + Intronic
1037910046 8:22738985-22739007 GCATGGTCCCAGCTTCAGCCTGG - Intronic
1039275013 8:35925737-35925759 GCCTGGGTCCATCATCAGACTGG + Intergenic
1039814065 8:41076576-41076598 GCCTGTTTCTGGCTTCTGACTGG + Intergenic
1040307045 8:46217494-46217516 GCAGGGTTCCTGCTTCAAAAAGG + Intergenic
1040415719 8:47193570-47193592 GGCTGGCTGCTGCTTCACACAGG + Intergenic
1040862071 8:52008972-52008994 GCCTGTTTCCTGGTTCATAGGGG - Intergenic
1042205925 8:66329518-66329540 GTCTGTTTCCTGCTGGAGACTGG + Intergenic
1043091586 8:75911585-75911607 GCCTGTTTCTGGCTTCTGACCGG - Intergenic
1043275614 8:78388655-78388677 GCCTGGCTCCTGCTCCAGCTTGG + Intergenic
1043706617 8:83358448-83358470 ACCTGCTTCCTTCTCCAGACTGG - Intergenic
1045117484 8:98999483-98999505 GTCTGGTTTCTGCCTCTGACTGG - Intergenic
1050838585 9:10116677-10116699 ACCTGACTCCTGCTTAAGACAGG - Intronic
1052341330 9:27367004-27367026 GTCTGTTACCTGCTCCAGACTGG + Intronic
1052852785 9:33387913-33387935 GCCTCCTCCCTGCTTCAGTCAGG + Intronic
1052996125 9:34552407-34552429 TTCTGCTTCCTGCATCAGACTGG + Intronic
1053372399 9:37574003-37574025 TCCTTGTACCTGCTTCAGTCAGG - Intronic
1053725111 9:40991778-40991800 CCCTGTTTCCTCCATCAGACAGG + Intergenic
1054340857 9:63860215-63860237 CCCTGTTTCCTCCATCAGACAGG - Intergenic
1056423468 9:86453133-86453155 GGCTTGTTCCTGGTTCAGAGAGG + Intergenic
1059481954 9:114598181-114598203 GGCTGGCTGCTGCTTCACACAGG - Exonic
1060414528 9:123421033-123421055 GCCTGCCTCCTGCTTCTGTCTGG - Intronic
1060827414 9:126694990-126695012 TCCTGGTTCCTGGCTCGGACAGG - Intronic
1061149789 9:128822165-128822187 GCCTGGCTCCTCCTTGAGGCTGG - Exonic
1062011404 9:134268903-134268925 GACTGCTTCCTTCTTCAGTCTGG + Intergenic
1062055571 9:134468237-134468259 GCCTGGGTCCTGTCTCAGCCTGG + Intergenic
1203449705 Un_GL000219v1:100211-100233 CCCTGTTTCCTCCATCAGACAGG - Intergenic
1186669825 X:11757817-11757839 GCCGGGTGCCTACTCCAGACCGG + Intergenic
1192139684 X:68637198-68637220 GGCTAGGTGCTGCTTCAGACAGG + Intergenic
1194142590 X:90223148-90223170 GCCTGCTTCCTGATCCAGAGTGG - Intergenic
1195046864 X:101062401-101062423 TCCTGGGTCCTGCTCCACACTGG + Intergenic
1195272941 X:103251028-103251050 ACCTAGTACCTGCTGCAGACTGG + Intergenic
1196272315 X:113726886-113726908 GTCTGGATCCTTCTTTAGACTGG + Intergenic
1198054923 X:132984571-132984593 TCCTGGTTTCTGCATAAGACAGG - Intergenic
1198145236 X:133849644-133849666 GCCTGATCCTTGCTGCAGACAGG + Intronic
1200488344 Y:3792249-3792271 GCCTGCTTCCTGATCCAGAGTGG - Intergenic
1200692238 Y:6318070-6318092 GGATTGTGCCTGCTTCAGACCGG + Intergenic
1201043034 Y:9856657-9856679 GGATTGTGCCTGCTTCAGACCGG - Intergenic
1201049910 Y:9922299-9922321 GGATGGTGCCTGCTTCAGTCTGG + Intergenic