ID: 1175731605

View in Genome Browser
Species Human (GRCh38)
Location 20:61358048-61358070
Sequence GCGCTCCTTCCCTGTCGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175731605 Original CRISPR GCGCTCCTTCCCTGTCGCTC TGG Intronic
901024313 1:6270971-6270993 ACGCTCCCTCCCTGGTGCTCAGG + Intronic
903286879 1:22282884-22282906 GAGCTCCTTTCCTCTCCCTCGGG + Intergenic
905179526 1:36157242-36157264 GCCCTCCTTCCCAGCCTCTCTGG + Intronic
905869351 1:41394359-41394381 GGGCTCCTGCCCTGTCACCCTGG - Intergenic
908085299 1:60625681-60625703 GCGTTCCTTCCCTTTCTCTTTGG - Intergenic
912962308 1:114207190-114207212 GCCCTCCTTCCCCATCACTCAGG + Intergenic
915511402 1:156388750-156388772 GCGCTCTGTCCCGGGCGCTCCGG - Intergenic
915628915 1:157137224-157137246 GCCCTCCCTCCATGTCCCTCTGG - Intronic
916055698 1:161067876-161067898 TGGCTCCTTCCCTATCCCTCAGG - Intronic
919913554 1:202126668-202126690 ACTCTCCTCCCCTGCCGCTCGGG + Intronic
920809260 1:209266906-209266928 GGGCTCCTTCCTTGTGGCTAAGG + Intergenic
922348909 1:224719972-224719994 GCCCTCCCTCCCTGTGGCCCAGG - Intronic
922695531 1:227729126-227729148 GGGCTCCTACCCTGTTCCTCTGG - Intronic
1069419317 10:68232061-68232083 GCGCTCCTTCCCTGAGCTTCGGG - Exonic
1069962740 10:72087958-72087980 GCGCCCCTCCCCTGTCCCTGCGG - Intronic
1070520650 10:77250135-77250157 GTGCTCCTTTCCTGTGGCTTGGG - Intronic
1070814015 10:79312133-79312155 GCCATCCTTCCCTGTGGCCCCGG - Intronic
1075212660 10:120504025-120504047 GCTCTCCTTCTCTTTCTCTCAGG - Intronic
1076574275 10:131453586-131453608 GCGCTCCTCCCCGGCCCCTCTGG + Intergenic
1076767180 10:132642585-132642607 CCTCTCCTCCCCTGTCACTCCGG + Intronic
1077460308 11:2705771-2705793 AAGCCCCATCCCTGTCGCTCTGG + Intronic
1082783813 11:57305617-57305639 GGGCACCCTCCCTGTCTCTCTGG - Intronic
1090517439 11:127444003-127444025 GCTCTTCTTCCCTGTCGATAAGG + Intergenic
1091208030 11:133833963-133833985 GCACACCCTCCCTGTCTCTCTGG + Intergenic
1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG + Exonic
1094514690 12:31119814-31119836 GCTCTCCGTCCCTGCCTCTCGGG - Intergenic
1096277068 12:50218542-50218564 GTGCTTCTTCCCTGTCTCCCAGG + Intronic
1096413450 12:51392858-51392880 GCGCTCCTTCTCTGTTGCTAAGG - Intronic
1105403912 13:20118541-20118563 AGGCTCCCTCCCTGGCGCTCCGG - Intergenic
1110630090 13:77697816-77697838 CGGCTCCTTCCCTGTCGCCCCGG - Intergenic
1118813522 14:69292464-69292486 GTGCTCCTTCCCTGGGGCTCTGG - Intronic
1119535043 14:75396049-75396071 GCCCTCCGTCCCTGCCACTCAGG - Intergenic
1122614882 14:103010421-103010443 GCTCTCCTCCCCTATCCCTCTGG + Intronic
1123135779 14:106026474-106026496 GAGCCCCTTCCCTGGAGCTCCGG + Intergenic
1123161019 14:106277940-106277962 GAGCCCCTTCCCTGGAGCTCCGG + Intergenic
1202841330 14_GL000009v2_random:124484-124506 GCGCTCCTGTCCTGCCGCTGAGG - Intergenic
1202910719 14_GL000194v1_random:114715-114737 GCGCTCCTGTCCTGCCGCTGAGG - Intergenic
1126702364 15:51379972-51379994 GGGATCCTTCCCTGTGACTCAGG + Intronic
1129297401 15:74607346-74607368 ACACTCCTCCCCTGTCTCTCTGG + Intronic
1133040684 16:3058611-3058633 GCGCGCCTTCCCAGAGGCTCAGG - Exonic
1134880953 16:17745170-17745192 GCGCTCCTTCCCTCTAACTCGGG + Intergenic
1137531940 16:49283350-49283372 GCGCTCCTGCCCTCTGCCTCTGG + Intergenic
1137683167 16:50368649-50368671 CCGCTCTTTCCCAGTGGCTCCGG - Intronic
1138030050 16:53552712-53552734 GCCCTCATTCCCTTTCTCTCTGG - Intergenic
1142566546 17:843975-843997 ACGGTCATTCCCTGTCGCTTTGG + Intronic
1142638628 17:1272227-1272249 GCTCTTCCTGCCTGTCGCTCGGG - Intergenic
1144058071 17:11559076-11559098 GTGCTCCTTCCCTGGCCCTGAGG + Exonic
1144065590 17:11621437-11621459 TTGTTCCTTCCCTGTCCCTCTGG - Intronic
1147649123 17:42051886-42051908 GCGCTCCATCCCAGCAGCTCTGG - Intronic
1148558995 17:48595276-48595298 CCGCTCCTGGCCTGTGGCTCTGG - Intronic
1151876217 17:76869411-76869433 GCGCCCCTTCCCAGCCCCTCAGG + Intronic
1151925456 17:77192686-77192708 GGGATCTTGCCCTGTCGCTCAGG + Intronic
1157476812 18:48029014-48029036 GGCCTCCCTCCCTGTCTCTCTGG - Exonic
1157616754 18:48991695-48991717 GGGCTCCTTCCTTCTCCCTCCGG - Intergenic
1160766660 19:811723-811745 CCGCCCCTTCCCTGAAGCTCAGG - Exonic
1160877407 19:1303171-1303193 CCCCTCCTTCCCTGTCTCTGTGG + Intergenic
1162911026 19:13847793-13847815 GCGCTCACTTCCTGTCGCCCCGG + Intergenic
1163716129 19:18873370-18873392 GCACTCCTGCTCTGTCTCTCTGG - Intronic
1166689870 19:44815984-44816006 GGGGTCTTTCTCTGTCGCTCAGG - Intronic
1167386484 19:49166921-49166943 GGTCTCCGTCCCTGTCTCTCCGG + Intronic
1168115034 19:54217620-54217642 CCGCTCCCTCCCTGTGGTTCTGG + Intronic
1168120726 19:54251312-54251334 CCGCTCCCTCCCTGTGGTTCTGG + Intronic
1168181955 19:54667470-54667492 CCGCTCCCTCCCTGTGGTTCTGG - Intronic
925377752 2:3400428-3400450 GCGCTGCTTCCCTTTCCCCCTGG + Intronic
930841043 2:55845724-55845746 GGGCTCCTTCCATGTTGCCCAGG + Intergenic
934902035 2:98167131-98167153 CCGCCCCTTCCCTGTCCCGCTGG - Intronic
935103696 2:100020224-100020246 GGTCTCCTTCCCTGGCCCTCTGG + Intronic
937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG + Intergenic
938273087 2:129992777-129992799 GCGCTCCCTCCCTCTCTCGCTGG - Intergenic
938443137 2:131353329-131353351 GCGCTCCCTCCCTCTCTCGCTGG + Intronic
947566853 2:231199719-231199741 GGAGTCTTTCCCTGTCGCTCAGG + Intronic
948053012 2:234992461-234992483 GCGTTCCTGCCATGTAGCTCTGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1169391241 20:5192988-5193010 GCTTTCCTTCCCTCTAGCTCAGG + Exonic
1171087094 20:22247475-22247497 GGGCTCCTTCCCTGTGTCCCTGG - Intergenic
1171124002 20:22586298-22586320 AAGCTCCTTCCCTGGCGCACCGG - Intergenic
1172091658 20:32436953-32436975 GAGCCCCTTCCCTGGCTCTCGGG - Exonic
1173649778 20:44655808-44655830 GCTCTCCTGCCCTCTGGCTCTGG + Intergenic
1173745099 20:45430153-45430175 GGTCTCCTTCCCTGTCACCCAGG - Intergenic
1174801542 20:53566959-53566981 GTGCTCCTGCTCTGTCACTCAGG - Intergenic
1175262279 20:57682100-57682122 GAGCTCCTTCCCTGTGCCACTGG - Intronic
1175731605 20:61358048-61358070 GCGCTCCTTCCCTGTCGCTCTGG + Intronic
1176040440 20:63062650-63062672 CCGGCCCTTCCCTGTCACTCCGG + Intergenic
1176408987 21:6437550-6437572 GAGTGCCTTCCCAGTCGCTCTGG + Intergenic
1176547676 21:8208648-8208670 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176555573 21:8252854-8252876 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176574503 21:8435882-8435904 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176597380 21:8759387-8759409 GCGCTCCTGTCCTGCCGCTGAGG + Intergenic
1176611115 21:8987174-8987196 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176643206 21:9325349-9325371 GCGCTCCTGTCCTGCCGCTGAGG + Intergenic
1179684480 21:43045872-43045894 GAGTGCCTTCCCAGTCGCTCTGG + Intergenic
1180369730 22:11973867-11973889 GCGCTCCTGTCCTGCCGCTGAGG - Intergenic
1180376510 22:12098238-12098260 GCGCTCCTGTCCTGCCGCTGAGG + Intergenic
1180835022 22:18925531-18925553 GGGCACCTGCCCTGTCGCTCTGG - Intronic
1183962183 22:41418186-41418208 GACCTCCCTCCCTGTCCCTCTGG + Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185294167 22:50045249-50045271 GCGCACCTTGCCTGCTGCTCAGG + Exonic
1203252550 22_KI270733v1_random:124933-124955 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1203260606 22_KI270733v1_random:170019-170041 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1203285111 22_KI270734v1_random:150830-150852 GGGCACCTGCCCTGTCGCTCTGG - Intergenic
953392736 3:42543296-42543318 GCTTTCCTTCTCTGTCCCTCAGG - Intergenic
957096874 3:75785236-75785258 GCGCTCCTGTCCTGCCGCTGAGG - Intronic
957107301 3:75906908-75906930 GGGCTGCTTCCCTGTCCCCCTGG + Exonic
957273961 3:78066218-78066240 GCACACCTTCCCTTTTGCTCTGG + Intergenic
959503193 3:107130535-107130557 GAACTCCTTCCCTCTCACTCAGG - Intergenic
963494523 3:146042871-146042893 GTCCTGCTTCCCAGTCGCTCCGG - Intergenic
971188290 4:24402294-24402316 GCGATCCTTTCCTGTCGCTGGGG - Intergenic
973360677 4:49161606-49161628 GCGCTCCTGTCCTGCCGCTGAGG + Intergenic
979349484 4:119628135-119628157 GAGCCCCTTCCCTGCAGCTCCGG - Intronic
1202758110 4_GL000008v2_random:83671-83693 GCGCTCCTGTCCTGCCGCTGAGG + Intergenic
986023672 5:3829040-3829062 GCACTTCTTACCTGTGGCTCAGG + Intergenic
986720455 5:10557385-10557407 GCCCTCCTTCCCTGGGACTCTGG - Intergenic
988481987 5:31639052-31639074 GCCCCCCGTCCCTGTCACTCGGG + Intergenic
992817447 5:80457998-80458020 GCTCTGTTTCTCTGTCGCTCAGG - Intronic
997794443 5:136794669-136794691 GGACTCCTTTCCTGTCTCTCTGG + Intergenic
998418052 5:141959663-141959685 GCACTCCTTCCCTTTCTCTCTGG + Intronic
1004928648 6:20440513-20440535 TGGCTCCTTCTCTGTCTCTCAGG + Intronic
1005216465 6:23533967-23533989 GAGCTCATTCTCTGTAGCTCTGG - Intergenic
1006392057 6:33764301-33764323 TCTCTCCTTCCCTGTGGCCCAGG - Intergenic
1007367842 6:41407181-41407203 GCGTTCCGTCCCTGTCCCCCTGG - Intergenic
1007764444 6:44152523-44152545 TCCCTCCTTCCCTGCCCCTCTGG + Intronic
1011672379 6:89695556-89695578 GGGCTCCTTCCCTGACGTGCTGG - Intronic
1013816898 6:114109568-114109590 GCACTCCTTCCCTTCCTCTCTGG + Intronic
1018901849 6:168055639-168055661 GCGCACCTCCCCTGCCGCACAGG + Intergenic
1020188218 7:5974641-5974663 CTGCTCCTTCCCTCTCGCCCTGG - Intronic
1020294699 7:6750127-6750149 CTGCTCCTTCCCTCTCGCCCTGG + Intergenic
1022156075 7:27662930-27662952 GCGCTCCTTCCCTCGCGCGTGGG - Exonic
1024394787 7:48853840-48853862 GCAGTCTTTCTCTGTCGCTCAGG + Intergenic
1026728950 7:72894681-72894703 GATCTCCGTCCCTGTCGCCCAGG + Intronic
1032489531 7:132313838-132313860 GCCCTCCTACCCTGTCTCTAAGG + Intronic
1034441026 7:151086265-151086287 GCGCTCCAGCCCTGGCGCCCCGG - Intronic
1035376816 7:158411819-158411841 GGGCTGCTTCTCTGTGGCTCAGG + Intronic
1035679593 8:1478271-1478293 GCCCTCCTTCCCTTTCCTTCAGG + Intergenic
1035694662 8:1586167-1586189 GCCCTCCTTCCGGGTCTCTCTGG + Intronic
1050591306 9:7163122-7163144 CAGCTCCTTCCCTTTCTCTCTGG - Intergenic
1053073757 9:35116003-35116025 GAGCTCCTCCCCTGTAGCCCGGG + Intronic
1059282801 9:113149271-113149293 GCACTCCTTCCCTGTCCCCCAGG - Intergenic
1061977037 9:134074145-134074167 GGGCTCCTTCTCTGTGGCTGGGG - Intergenic
1203468954 Un_GL000220v1:108084-108106 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1203476775 Un_GL000220v1:152056-152078 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1203712312 Un_KI270742v1:109644-109666 GCGCTCCTGTCCTGCCGCTGAGG - Intergenic
1203538899 Un_KI270743v1:68543-68565 GCGCTCCTGTCCTGCCGCTGAGG + Intergenic
1203555916 Un_KI270743v1:207970-207992 GCGCTCCTGTCCTGCCGCTGAGG - Intergenic
1192117646 X:68426669-68426691 GCGGTCCTGCCATGTTGCTCAGG - Intronic
1198306970 X:135393180-135393202 GCCTTCCTTCCCTGCCACTCAGG + Intergenic