ID: 1175733063

View in Genome Browser
Species Human (GRCh38)
Location 20:61367116-61367138
Sequence GTGCAGGTCCTCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 1, 3: 45, 4: 394}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175733052_1175733063 7 Left 1175733052 20:61367086-61367108 CCAGTCCACCCAAGCCCTGACTG 0: 1
1: 0
2: 1
3: 12
4: 245
Right 1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG 0: 1
1: 1
2: 1
3: 45
4: 394
1175733058_1175733063 -8 Left 1175733058 20:61367101-61367123 CCTGACTGAGCAAATGTGCAGGT 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG 0: 1
1: 1
2: 1
3: 45
4: 394
1175733054_1175733063 -1 Left 1175733054 20:61367094-61367116 CCCAAGCCCTGACTGAGCAAATG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG 0: 1
1: 1
2: 1
3: 45
4: 394
1175733056_1175733063 -7 Left 1175733056 20:61367100-61367122 CCCTGACTGAGCAAATGTGCAGG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG 0: 1
1: 1
2: 1
3: 45
4: 394
1175733053_1175733063 2 Left 1175733053 20:61367091-61367113 CCACCCAAGCCCTGACTGAGCAA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG 0: 1
1: 1
2: 1
3: 45
4: 394
1175733055_1175733063 -2 Left 1175733055 20:61367095-61367117 CCAAGCCCTGACTGAGCAAATGT 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG 0: 1
1: 1
2: 1
3: 45
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175733063 Original CRISPR GTGCAGGTCCTCAGGGAGGA GGG Intronic
900096958 1:943692-943714 TTCCAGGTCTTCAGGGAGCAGGG + Exonic
900159498 1:1216740-1216762 GGGCAGGGGCTCTGGGAGGACGG - Intergenic
900176833 1:1294817-1294839 CTGCAGGTCCGCAGGGAAGGGGG + Intronic
900530918 1:3152816-3152838 GTCCCCGTCCTCAGGCAGGAGGG + Intronic
901157968 1:7153480-7153502 GTGCAGGTACGCAGGGAGGCAGG - Intronic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
902489009 1:16766898-16766920 TAGGAGGTCCTCAGGGAGGAGGG - Intronic
902880481 1:19368902-19368924 GTGCAGGGTCTCTGGCAGGATGG + Intronic
903762887 1:25711650-25711672 GGGCGGGGCCGCAGGGAGGAGGG - Intronic
903886793 1:26545645-26545667 TTGTAGGCCCACAGGGAGGATGG + Intronic
904331016 1:29757824-29757846 CTGCAGGGCCTCAGAGGGGATGG - Intergenic
904447482 1:30586946-30586968 GTGCAGGTGAACAGGGAGGGAGG - Intergenic
908114218 1:60925104-60925126 GTGCAGGACCTCAGGCAGCTGGG - Intronic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
911091774 1:94022889-94022911 GTGCAGTTCCTGAGGGAGGCTGG + Intronic
911310649 1:96288775-96288797 GTGAAAGTCCACAGGGAGGCAGG - Intergenic
912474925 1:109929129-109929151 GTGCAGCCCCTGAGGGAAGAGGG - Exonic
912711086 1:111950434-111950456 GTGCCGGTCCTCAGGGAGTGAGG - Intronic
913183428 1:116344696-116344718 GAGGAGGCCCTCAGTGAGGAGGG - Intergenic
913460905 1:119085195-119085217 GCACAGGTCCTCAAGCAGGAGGG - Intronic
914346047 1:146799366-146799388 GTGCAGGTTGTCAGGGAAGTGGG - Intergenic
914916547 1:151822679-151822701 GTGAAGGTGCTCTGGGATGAGGG - Intronic
915603506 1:156937074-156937096 GTGCTGGGCCTTGGGGAGGAGGG + Intronic
916644065 1:166764605-166764627 GTTAAACTCCTCAGGGAGGATGG - Intergenic
918130024 1:181619347-181619369 GTGAAGGCCCTGAGGAAGGAGGG + Intronic
920049134 1:203152767-203152789 GCGGTGGTCCTCAAGGAGGAGGG - Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920294149 1:204945679-204945701 GTGCATGTGCACAGGGAGGGAGG + Intronic
920380418 1:205531756-205531778 AGGCAGGTCCTGGGGGAGGAGGG - Exonic
920508296 1:206532509-206532531 CTGCTGGTCCTCAGGGAGAGAGG + Intronic
920756724 1:208739986-208740008 GTGGCGCTCCTCAGGGAGGCTGG - Intergenic
923531427 1:234815626-234815648 TAGGAGGTCCTCAGGGAGGAGGG + Intergenic
924321433 1:242854910-242854932 ATGCAGGTCATCAGGGAAGTAGG + Intergenic
924641328 1:245836357-245836379 GTTCAGGACCGCACGGAGGATGG - Intronic
1063975765 10:11414307-11414329 GTTCCAGTCCACAGGGAGGAAGG - Intergenic
1064085635 10:12344351-12344373 ATGCAGTTGCTCAGGGAAGACGG - Intergenic
1066555860 10:36612411-36612433 GTGGAGGTCCTCTGGGAGCTGGG - Intergenic
1067458953 10:46443378-46443400 GTACTGGTCCTCCCGGAGGAGGG + Intergenic
1067628242 10:47941254-47941276 GTACTGGTCCTCTCGGAGGAGGG - Intergenic
1068705863 10:60074612-60074634 GTGGAAGTCCTCATGGAGGCTGG + Exonic
1069844243 10:71359639-71359661 CTGCAGGTCCTCAGGGTGGGAGG + Intronic
1070916482 10:80158349-80158371 GTGCTGCTGCTCAGGCAGGAGGG + Intronic
1071277203 10:84066093-84066115 AGGCAGTTCCTCAGGCAGGAGGG + Intergenic
1072531960 10:96327960-96327982 TTGCAGGTACTCAGGGAGCATGG - Intronic
1073222652 10:101888834-101888856 GTGCAGGCACTCTGGGAGAAGGG + Intronic
1073328875 10:102658127-102658149 GTTGAGGTCAGCAGGGAGGAGGG + Exonic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1073777010 10:106797798-106797820 GTCCAGGTACCCAGGGAGCAGGG + Intronic
1074287942 10:112115995-112116017 CAGCAGGTCCCCAGTGAGGAGGG - Intergenic
1074298304 10:112211020-112211042 GTGCAGGTGCTTGGAGAGGAAGG + Intronic
1076888783 10:133274227-133274249 GTGCAGGCCCTGAGCGAGGAGGG + Exonic
1076994340 11:290845-290867 CTGCAGGGCCTCAGTGAGGCAGG - Exonic
1077074373 11:693891-693913 GAGCAGGTCCTTAGGGAAAAAGG + Intronic
1077156220 11:1092951-1092973 GTGAAGGTGGTCAGGGTGGACGG - Intergenic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1078337105 11:10473357-10473379 CTCCAGGTCTTTAGGGAGGAAGG + Intronic
1081666592 11:44920303-44920325 ATGCAGGTCCAAAGGGAGGGAGG + Intronic
1081814245 11:45929661-45929683 GGTGGGGTCCTCAGGGAGGAAGG + Intronic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1084771611 11:71346111-71346133 TTGCAGGTCCTCAGGCAGCAGGG - Intergenic
1085350558 11:75795662-75795684 GTTCAGGTTCTAAGGCAGGAAGG - Intronic
1085531682 11:77195477-77195499 GAGGAGGCCCTCAGGGAGGTGGG - Intronic
1088368066 11:109059784-109059806 GTGCAGGGCATATGGGAGGATGG + Intergenic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089343153 11:117773227-117773249 ATGCAGGTGCCCTGGGAGGAGGG - Intronic
1089395867 11:118136073-118136095 GTGCAGCCTCTCAGGTAGGAGGG + Exonic
1089554873 11:119310760-119310782 GTGCAGGCGCTCAGGGAAGCAGG - Exonic
1089708895 11:120300864-120300886 GTGCAGGTGCTAAGGGCGGAAGG - Intronic
1090933838 11:131324260-131324282 GTGCAGGTGCCCAGAGCGGAAGG - Intergenic
1091078496 11:132643437-132643459 ATGCAGAGCCTCAGGGAGGCTGG + Intronic
1096081046 12:48832729-48832751 GAGCAGGTACTCAGGAAGGATGG - Intronic
1097181220 12:57173132-57173154 GTGGAGGGCCTCAGGAGGGAGGG - Intronic
1097195739 12:57241695-57241717 GAGCAGGTCCCCAGAGAGGGCGG - Intergenic
1100819867 12:98420849-98420871 GTGCAGGTACTCTGGGAGATGGG + Intergenic
1101903141 12:108806521-108806543 GTGCATGTTCTCAGGCAGCAGGG + Intronic
1102581569 12:113891537-113891559 GTCCAGGTGGACAGGGAGGAAGG + Intronic
1102658282 12:114502187-114502209 ATTCAGGACCTCAGGGAGAAAGG - Intergenic
1102786805 12:115611681-115611703 GTGCAGGTGGCCAGGGAGCAGGG - Intergenic
1102975910 12:117207212-117207234 TTTAGGGTCCTCAGGGAGGAGGG + Intergenic
1104830290 12:131746295-131746317 CTGTAGGTCCTCAGCTAGGAAGG - Intronic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1106181591 13:27374045-27374067 GTGCAGGGCCTCTGGGAGCCTGG - Intergenic
1106938495 13:34750330-34750352 CTGCAGGACCACAGGGAGGGAGG + Intergenic
1107851525 13:44576934-44576956 GCACACGTCCTCGGGGAGGAAGG + Intronic
1109443253 13:62401329-62401351 GTTCAGGTCAACAGGCAGGAGGG - Intergenic
1110181778 13:72626027-72626049 GTACAGGTCATCAGGGAAGTCGG - Intergenic
1112131661 13:96531559-96531581 GTGCAGGTCAGCAGGGCAGAGGG + Intronic
1113093517 13:106639100-106639122 GTGGATGTGCTCAGGGAGGTGGG + Intergenic
1113748593 13:112763326-112763348 CTGCTGGTCCAAAGGGAGGAGGG - Intronic
1114536287 14:23425065-23425087 TTTCAGGACCTCAGGTAGGAAGG - Intronic
1114633111 14:24172194-24172216 GAGCAGGTCCCGAGGGAGCACGG - Exonic
1114657766 14:24326226-24326248 GAGCAGACCCCCAGGGAGGATGG + Intronic
1114995284 14:28342933-28342955 GTGCAGGTTCCCAAGGTGGATGG + Intergenic
1116171423 14:41407469-41407491 TTACAGATCCTCAGGAAGGAGGG + Intergenic
1117768458 14:59107728-59107750 GTGCAGGTTATCAGGGAAGTTGG - Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1119195515 14:72714376-72714398 GGGCAGGCGCACAGGGAGGAAGG + Intronic
1119599343 14:75964555-75964577 GTTCCTGTCCTCAGTGAGGATGG - Intronic
1119754398 14:77104617-77104639 GTGAAGGCCCTAAGGGAGCAAGG - Intronic
1120640211 14:87001245-87001267 CTGCAGGCACTCAGGGAGAATGG - Intergenic
1120822543 14:88926230-88926252 TCCCAGGTCCTGAGGGAGGAGGG + Intergenic
1121253445 14:92515326-92515348 GAGGAGTTTCTCAGGGAGGAAGG + Intronic
1122177440 14:99931491-99931513 GTCCAGGTGCTCAGGGCAGAAGG - Intronic
1122203884 14:100138750-100138772 GTGCAGGGCCACATGGTGGAAGG + Intronic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1124504602 15:30262006-30262028 CTTCAGGACCTCAGGGAGTAGGG + Intergenic
1124602617 15:31147852-31147874 GTCCAGGTCCCCAGGGAGGTGGG + Intronic
1124738950 15:32276629-32276651 CTTCAGGACCTCAGGGAGTAGGG - Intergenic
1125727481 15:41875441-41875463 CTGCAGGTCCACTGGGAAGAGGG - Exonic
1126111535 15:45178025-45178047 TTCCAGGTCCTTAGGGAGGATGG - Intronic
1127258888 15:57313347-57313369 GTTCAGCTCCTCAGGAAGGCAGG - Intergenic
1128238711 15:66085059-66085081 GTGCAGGTTGTCAGGGAAGTGGG - Intronic
1128681776 15:69657697-69657719 GTGCACGTTCACAGGAAGGATGG - Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128876556 15:71206339-71206361 GTGCAGGAGCTCGGGGAGGTGGG - Intronic
1129233241 15:74208431-74208453 GTCAATGTCCTCAGTGAGGAAGG - Intronic
1129262694 15:74377505-74377527 TGGCAGGTGCTCAGTGAGGAAGG - Intergenic
1129354487 15:74980519-74980541 GTCCAGGTCCTCAGAGAAGGTGG - Intronic
1130074100 15:80673990-80674012 CTGCGGGACCTCCGGGAGGAGGG - Intergenic
1130105931 15:80928523-80928545 GTGCTGGTCCTGAGAGCGGAAGG + Intronic
1130789142 15:87133489-87133511 GTGCAGGGTCTCAAGGAGAAGGG + Intergenic
1130904399 15:88229652-88229674 GGGCAGGACCTCAGGGATGCTGG - Intronic
1131059691 15:89397165-89397187 AAGCAGGTCCTCAGGGCAGAGGG - Intergenic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1132734223 16:1377643-1377665 CTGCCAGCCCTCAGGGAGGAGGG - Intronic
1132897252 16:2234922-2234944 GTGCGGGTCTTCCGTGAGGACGG - Exonic
1133967830 16:10544547-10544569 GTCCAGGCCCTCAGAGAGTATGG + Intronic
1134680344 16:16120593-16120615 GAGAAGGTGCTCATGGAGGATGG + Intronic
1135732531 16:24906926-24906948 AGGCAGAACCTCAGGGAGGACGG - Intronic
1136395292 16:29989051-29989073 GTCCAGCAGCTCAGGGAGGAAGG - Intronic
1136429165 16:30186940-30186962 GTGCAGGTGCTGCGGGAGGAGGG + Exonic
1136630244 16:31485670-31485692 GGTCAGATCCTCAGGGATGAGGG + Intronic
1136748727 16:32614561-32614583 GTGGAGGTCCACATGGAGAAAGG + Intergenic
1137374750 16:47943019-47943041 GTGCACGTCACCAGGGAAGAGGG - Intergenic
1139987932 16:70915901-70915923 GTGCAGGTTGTCAGGGAAGTGGG + Intronic
1140189599 16:72803950-72803972 GTACATGTACTCTGGGAGGAAGG - Intronic
1141230528 16:82162979-82163001 GGGCAGGGTCACAGGGAGGAAGG - Intronic
1141478934 16:84293429-84293451 GTGAGGGTCCCCAGGGAGGGAGG + Intergenic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1141720171 16:85751367-85751389 GTGCAGGGCCTCAGGGAGCCCGG - Intergenic
1141945210 16:87304995-87305017 ATGCAGGCCCCCAGGCAGGAAGG + Intronic
1142133354 16:88441001-88441023 GGGGAGGTCCTCAGTGAGGATGG - Intergenic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1203050861 16_KI270728v1_random:873775-873797 GTGGAGGTCCACATGGAGAAAGG + Intergenic
1143200410 17:5109484-5109506 TTGGAGCTCCTCAGGCAGGATGG + Exonic
1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG + Intergenic
1143362969 17:6386618-6386640 GTGGAAGTCCTCAGAGAAGAAGG - Intergenic
1145270362 17:21401524-21401546 GAGCAGTTCATAAGGGAGGAAGG + Intronic
1145308575 17:21688921-21688943 GAGCAGTTCATAAGGGAGGAAGG + Intergenic
1145818115 17:27810234-27810256 ATGCAGGTCCTCAGGGAAGCAGG - Intronic
1146588793 17:34109723-34109745 GAGCAAGTCCTCAATGAGGAAGG - Intronic
1147966860 17:44198822-44198844 GGGCTGGTCCTGAGGGAGGGCGG - Intronic
1148038697 17:44689338-44689360 CTGCAGGTACACAGAGAGGAAGG - Intronic
1148739567 17:49884895-49884917 GAGCAGTTCCTCAGGGTGGGGGG - Intergenic
1148962764 17:51407182-51407204 GTGCAGGTCCTCAGTGCAGGTGG - Intergenic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151469512 17:74309414-74309436 ATCCAGGTCCTCAGGGAGCCAGG + Intronic
1151557983 17:74856297-74856319 GTGCAGATCCTGGGGGAGGCGGG - Intronic
1152064775 17:78104805-78104827 GAGCAGGTCCCCAGGCAGCAGGG - Exonic
1152657112 17:81524874-81524896 GTGAAGGTGCTCATGGATGAGGG - Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1152904924 17:82964984-82965006 GTGCACTCCCACAGGGAGGACGG + Intronic
1152904935 17:82965025-82965047 GTGCACACCCACAGGGAGGACGG + Intronic
1152923842 17:83078991-83079013 CTGCACGTCCTCCGGGAGGAGGG + Intergenic
1153065435 18:1039738-1039760 ATGCAGGTCATCAGGGAAGTAGG - Intergenic
1153778702 18:8476065-8476087 GAGCATGTTCTCTGGGAGGAGGG + Intergenic
1154131294 18:11738866-11738888 GTGCAGGTTGCCAGGCAGGACGG + Intronic
1154293587 18:13131201-13131223 TGCCAGGTCCTCAGGGAAGATGG + Intergenic
1155490628 18:26398053-26398075 GTGACAGCCCTCAGGGAGGAGGG - Intergenic
1156242025 18:35264038-35264060 TTGCAGCTCCTCAGGAAGGATGG + Exonic
1157294577 18:46433418-46433440 GTGCAGGGCCTGAGGTAGGAAGG - Exonic
1157657947 18:49410411-49410433 GTGTTGGTCCTCAGGGATTAAGG + Intronic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1158060146 18:53330647-53330669 GTGCAGGTAGGCAGGCAGGATGG - Intronic
1158517900 18:58146196-58146218 GTGCTGATCCTCAGGAAGGTGGG + Intronic
1158888781 18:61853936-61853958 GGGCAGGTGGGCAGGGAGGATGG - Intronic
1159486333 18:69063026-69063048 GTTCTGGTTCTCAAGGAGGATGG - Intergenic
1159583423 18:70260749-70260771 CTGCAGGTCCACAGGCAGGAAGG + Intergenic
1160905607 19:1450339-1450361 GTGTGTGTCCTCGGGGAGGAGGG + Intronic
1160975828 19:1791963-1791985 GAGCAGGACCTCAGGGTGGGTGG - Intronic
1161001722 19:1914171-1914193 GGGCAGGAAGTCAGGGAGGAGGG + Intronic
1161086581 19:2338303-2338325 GTGCAGGGGCTCAGGGCCGAGGG + Intronic
1161102789 19:2429522-2429544 AGGCAGGTCCCCAGGGAGGCGGG + Exonic
1161195382 19:2983535-2983557 GTGAAGGCCCTGAGGCAGGACGG + Intronic
1161322338 19:3647042-3647064 GTGCAGGTGCTCACAGAGGGAGG + Intronic
1161322362 19:3647118-3647140 GTGCAGGCACTCACAGAGGAGGG + Intronic
1161322371 19:3647152-3647174 GTGCAGGCACTCACAGAGGAGGG + Intronic
1162054725 19:8055827-8055849 GTGCAGGTGCACTGTGAGGAGGG - Intronic
1162367515 19:10258402-10258424 GTGCAGGTCGTCCTGGTGGAAGG - Exonic
1162523826 19:11196629-11196651 GTGCTGGTCCTCATCGAGGGCGG - Intronic
1163187920 19:15652731-15652753 ATTGAGGACCTCAGGGAGGATGG - Intronic
1163201098 19:15769784-15769806 ATTGAGGCCCTCAGGGAGGATGG + Intergenic
1163216973 19:15886123-15886145 ATTGAGGGCCTCAGGGAGGATGG + Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163787261 19:19281217-19281239 ATCCATGTCCTCAGGGAGCATGG - Intronic
1164778010 19:30869432-30869454 GTGGCTGTCCTCAGGGAGCAAGG - Intergenic
1165472464 19:36011241-36011263 GTGGAGGTCCTGAGGGATTAGGG - Intronic
1166142291 19:40811567-40811589 TTCCAGGTCCTAAGGGAAGAAGG - Intronic
1166218908 19:41353165-41353187 GCTGAGGTCCTCAGGGAGAAGGG + Exonic
1166295767 19:41888572-41888594 GGGCAGGTGTTCAGGGAGAATGG - Intronic
1166662095 19:44654022-44654044 GTCCTGGGTCTCAGGGAGGAGGG + Intronic
1167247671 19:48383422-48383444 GGGCAGATCCACAGGGAGGGAGG + Intronic
1167471326 19:49677729-49677751 GCCCAGGTCCCCGGGGAGGAGGG - Intronic
1167596915 19:50432724-50432746 AGCCAGGTCCCCAGGGAGGAGGG - Intergenic
1167667998 19:50833784-50833806 GAGCAGTTCCTCAAGGGGGAGGG + Intronic
1168135650 19:54349481-54349503 ATGCAGATCCTGAGGGTGGACGG + Intergenic
1168238065 19:55075999-55076021 CTCCAGGGTCTCAGGGAGGACGG + Intronic
1168253891 19:55155869-55155891 CTTCAGGGTCTCAGGGAGGAGGG + Intronic
1168269397 19:55241441-55241463 GTTCTGGTCCTCGGGGAGGCGGG - Intronic
1168277600 19:55286052-55286074 GTGCTGGGTCTGAGGGAGGAGGG + Intronic
1168277614 19:55286089-55286111 GTGCTGGGTCTGAGGGAGGAGGG + Intronic
1168277627 19:55286126-55286148 GTGCTGGGTCTGAGGGAGGAAGG + Intronic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926619963 2:15038685-15038707 CTGCTTGTCCTCGGGGAGGAAGG - Intergenic
926782631 2:16488272-16488294 GTGGAGGTCCGCACTGAGGAAGG + Intergenic
927257648 2:21054210-21054232 GGGCCGGTCCTCAGTGAGGCAGG - Intergenic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
928314704 2:30236276-30236298 GGGCAGGTGGTGAGGGAGGAAGG + Intronic
928315887 2:30245476-30245498 CTGTAGGTCCTCAGAGGGGAGGG + Intronic
929789111 2:45010721-45010743 GTGCTGGTCCTGTGGGAGAAGGG + Intergenic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
930844650 2:55889069-55889091 CTGCAAGGCCTCAGGGAGGGAGG - Intronic
931153623 2:59602919-59602941 GGGCAGGGCTCCAGGGAGGAGGG - Intergenic
932178010 2:69620311-69620333 GGGCAGTTCCTCATGGAGCAAGG - Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932812231 2:74834869-74834891 GTGCCGGAGCTCAGGGAGGGAGG - Intronic
933110729 2:78397139-78397161 ATGCAGGTCCGCAGGGAAGTGGG - Intergenic
933759768 2:85665467-85665489 AGGCAGGGCCTAAGGGAGGAGGG - Intronic
934745103 2:96754191-96754213 GTGGAATTCCTCTGGGAGGAAGG - Intergenic
936236022 2:110743546-110743568 GTTCAGAGACTCAGGGAGGAGGG + Intronic
937295775 2:120808970-120808992 CTCCAGGTCATCAGGGAGGGAGG + Intronic
938653373 2:133406866-133406888 ATGCAGGTCCCCTGGAAGGAAGG - Intronic
938904524 2:135825750-135825772 GTGCAGGTGCTCCGGGGAGAGGG + Intronic
940034730 2:149301820-149301842 GTGCAGGTTGTCAGGGAAGTAGG + Intergenic
941428580 2:165383376-165383398 GTGAAGGTCCTTATGTAGGAGGG + Intronic
941659358 2:168179793-168179815 GTGGAGGTCAGCAGGGAGGCTGG - Intronic
944083107 2:195812183-195812205 GGGCAGGGCGTTAGGGAGGAGGG - Intronic
944602102 2:201313445-201313467 GTGCAGGTTGTCAGGGAAGTAGG - Intronic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
946372700 2:219290388-219290410 GGGCAGGTCCCCTGGGAGGAAGG + Intronic
946404379 2:219484643-219484665 GTGCAGGACCTCAGGGCTGTCGG + Exonic
947952605 2:234161102-234161124 GAGCAGCTCCACAGAGAGGATGG + Intergenic
948453669 2:238093989-238094011 GGGCAGGTGCCCAGAGAGGAGGG + Intronic
948772734 2:240259787-240259809 GTGCAGCTCCTCCAGCAGGAGGG - Intergenic
948968056 2:241400157-241400179 GTGCAGGGGCTCAGGTAGGACGG + Intronic
949049007 2:241887234-241887256 ATGCAAGTCCTCAGGGAGCTCGG + Intergenic
1168948426 20:1780355-1780377 GAGAAGGACCTCAGGCAGGAAGG + Intergenic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1168972712 20:1941719-1941741 GGCCTGGTCCTCATGGAGGAAGG - Intergenic
1169267385 20:4174882-4174904 GTCCAGGTCCTCAGAGAGGGAGG + Intronic
1169935624 20:10880461-10880483 TTGCAGGGCCTGAGGCAGGATGG + Intergenic
1170050980 20:12144993-12145015 GAGCAGGTCATCAGTGGGGATGG + Intergenic
1170700573 20:18699552-18699574 GAGGTGGTCATCAGGGAGGATGG + Intronic
1171160323 20:22916506-22916528 GTGCAGGTTGTCAGGGAAGTTGG + Intergenic
1171946948 20:31387355-31387377 TTGCAGGTCCTGAGGCAAGAAGG + Intronic
1171958652 20:31477790-31477812 GAGCTGGATCTCAGGGAGGACGG - Intronic
1172244867 20:33438861-33438883 GTGCAGGTCCTCAAGAAGACAGG - Exonic
1174071851 20:47905113-47905135 GGGCAGGTCGTCATGAAGGAGGG + Intergenic
1174152202 20:48493556-48493578 GGGCAGGTCGTCATGAAGGAGGG - Intergenic
1174395964 20:50247065-50247087 GAGCAGGTCCGCAGGAGGGACGG + Intergenic
1174561078 20:51431323-51431345 GTCCAGGATCTCAGGGAGGAAGG - Intronic
1175495772 20:59413206-59413228 CTCCAGGGCCTCAGGGAGGGTGG - Intergenic
1175577960 20:60076784-60076806 ATGCAGCTACACAGGGAGGAAGG - Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1176075271 20:63245440-63245462 CTGCAGGTCCCCAGGCAGGAGGG - Intronic
1176106914 20:63393766-63393788 GTGCCAGCCCTCAGGGAGGACGG + Intergenic
1176292880 21:5055556-5055578 GTGCAAGTTCTCAGGGAAGCAGG - Intergenic
1178732848 21:35120642-35120664 GTGCAGGTCACCAGGGAAGTGGG - Intronic
1178884728 21:36476214-36476236 GTGCAGGGCCACAGGAGGGAAGG - Intronic
1178977741 21:37234045-37234067 GAGCAGGTGCCCAGCGAGGAAGG - Intronic
1179293952 21:40044036-40044058 GTGCTGGTCCCCAGGGACGGAGG + Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1179864380 21:44208094-44208116 GTGCAAGTTCTCAGGGAAGCAGG + Intergenic
1180260265 21:46663589-46663611 GTGCCGGTCCTCAGGGAGACAGG + Intronic
1180631340 22:17232307-17232329 ATGCAGGTCCTCAGACAGCAGGG - Intergenic
1180954842 22:19737003-19737025 GGGCAGGTCCTCAGGGGTGGGGG - Intergenic
1181854436 22:25772089-25772111 GTGCAGGACCACAGCGAAGAGGG + Intronic
1181955550 22:26585525-26585547 ATGCAGGTCCTCAGAGGGCACGG + Intronic
1182120022 22:27780349-27780371 GGGCAGGTCCTAAGGCAGGACGG - Intronic
1182429483 22:30291495-30291517 GCCCAGGCCCTCAGGGAGGGGGG - Intronic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182521873 22:30889397-30889419 GTGCCAGTCCTCAGGGTGGAGGG + Intronic
1183048465 22:35241185-35241207 ATGCAGGTTGTCAGGGAAGAGGG + Intergenic
1183490192 22:38111810-38111832 CGGCAGGCCCTCAGGGAGGCTGG + Exonic
1183725456 22:39586757-39586779 GGACAGGTCCCCAGGGAGGCTGG + Intronic
1183903492 22:41022691-41022713 GTGCAAGGCCTCGGGGAGGGTGG + Intergenic
1184067239 22:42127799-42127821 GTGCAGGGGCCGAGGGAGGAAGG - Intronic
1184147003 22:42617668-42617690 GGGCAGGTTCACAGGAAGGAGGG - Intergenic
1184448860 22:44571031-44571053 TTGCAGGGCTTTAGGGAGGAGGG + Intergenic
1184850141 22:47115227-47115249 TTGCTGGTCCTCAGGAAGGGTGG + Intronic
950304600 3:11908231-11908253 CTGCTGGTGCTCAGGGTGGAGGG - Intergenic
954143181 3:48620941-48620963 GTGCAGGACCCCACGGAGCAGGG + Exonic
954855607 3:53641405-53641427 GTTCATATCCTCAAGGAGGATGG - Intronic
959162250 3:102736987-102737009 GTGCAGGTACTCTGGGAGATGGG + Intergenic
960534523 3:118802055-118802077 GTGCAGGTACTCTGGGAGATGGG - Intergenic
961372384 3:126439647-126439669 GGGCAGGTCCACAGTGAGGAAGG + Exonic
961374787 3:126456995-126457017 AGGCAGGCCCACAGGGAGGACGG + Intronic
961467720 3:127091637-127091659 GTGAAGGTCCCCAGGGAGAGAGG + Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961738429 3:129016718-129016740 GTACAGGGCCTGAGGCAGGAGGG + Intronic
962806906 3:138934191-138934213 ATCCAGGTCCTCAGGGCTGAAGG - Intergenic
964248648 3:154684485-154684507 GTGCAGGTCACCAGGGAAGTAGG + Intergenic
964710915 3:159670774-159670796 TTCCAGGACCCCAGGGAGGATGG - Intronic
966597327 3:181736484-181736506 GTGAAGGGCCCCAGGGAGAACGG - Intergenic
968624191 4:1619142-1619164 GTGCTGGAGCTCAGGGAGGATGG - Intronic
969662529 4:8538555-8538577 GAGCAGGGCCCCAGGGAGGCAGG + Intergenic
969668345 4:8575135-8575157 GTGCAGGTGATCAGGTAGGCAGG + Intronic
969966602 4:11003144-11003166 GGGCAGGTCCCCAGGGTGAATGG - Intergenic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
971229782 4:24791925-24791947 GTGCTGTTCCTCAGTGAAGAGGG - Intronic
973365978 4:49210050-49210072 GTGAACGCCCGCAGGGAGGAAGG - Intergenic
973394620 4:49582401-49582423 GTGAACGCCCGCAGGGAGGAAGG + Intergenic
974661032 4:64888786-64888808 GTCCAGCTCCCCAGGGAGTAAGG + Intergenic
981835708 4:149050968-149050990 GAGCAGGACCTCAGGGAAGGAGG - Intergenic
983627521 4:169816570-169816592 GAGAAGGACATCAGGGAGGAAGG + Intergenic
984281446 4:177675355-177675377 GTCCAGGACCTCAAGGAGGCCGG - Intergenic
985355737 4:189116891-189116913 GTACAGGTCCCCAGGGAAGTGGG - Intergenic
985556091 5:558710-558732 CTGATGGTCCTCACGGAGGATGG + Intergenic
985556110 5:558783-558805 CTGATGGTCCTCACGGAGGATGG + Intergenic
985556129 5:558856-558878 CTGATGGTCCTCACGGAGGATGG + Intergenic
985556148 5:558929-558951 CTGATGGTCCTCACGGAGGATGG + Intergenic
985556167 5:559002-559024 CTGGTGGTCCTCACGGAGGATGG + Intergenic
985556206 5:559148-559170 CTGGTGGTCCTCACGGAGGATGG + Intergenic
987071044 5:14337456-14337478 GTGAAGGTCCTCAGTGACGCAGG - Intronic
987644255 5:20648500-20648522 GTGCAGGTTCCCAGGGTAGAGGG - Intergenic
990155806 5:52876053-52876075 GTGAAAATCCTCAAGGAGGAAGG - Intronic
991650172 5:68844624-68844646 ATGCAGATCCTCAGAGAGGAAGG - Intergenic
995658898 5:114458937-114458959 GTGCGGGTGCTGAGGGAGGCAGG + Intronic
995710847 5:115034054-115034076 CTGCAGGTCCTCATGGTGGCAGG - Intergenic
997674829 5:135705129-135705151 GAACAGGCCCGCAGGGAGGACGG - Intergenic
998406844 5:141878815-141878837 GAGCAGGTGCCCAGGGAAGAAGG - Intronic
999314804 5:150576517-150576539 ATGCAGGCCCTCTGGGAGGGAGG + Intergenic
1001293701 5:170484398-170484420 GTGCAGGCCCTCCAGGAGGCTGG + Intronic
1001611537 5:173006764-173006786 AGGCAGGTACTCAGAGAGGAAGG - Intronic
1001977188 5:176009768-176009790 CTGCAGGTCTTCAGGCTGGAGGG - Intronic
1001990603 5:176112937-176112959 GTGGAGGTCCACAGGGTGAAAGG + Intronic
1002226270 5:177725203-177725225 GTGGAGGTCCACAGGGTGAAAGG - Intronic
1002240237 5:177834012-177834034 CTGCAGGTCTTCAGGCTGGAGGG + Intergenic
1002267581 5:178046010-178046032 GTGGAGGTCCACAGGGTGAAAGG + Intronic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003029449 6:2589330-2589352 ATGCAGGTTGTCAGGGAGGTGGG + Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1005675336 6:28148709-28148731 CTGGAGCTCCTCAGGTAGGATGG - Exonic
1005700719 6:28398097-28398119 CTGGAGCTCCTCAGGTAGGATGG + Exonic
1005719370 6:28586391-28586413 CTGGAGCTCCTCAGGCAGGATGG + Exonic
1006425076 6:33958668-33958690 GGCCAAGTCCTCAGGGAAGAAGG + Intergenic
1006928147 6:37670392-37670414 GTGCAGGGCTTCAGAGGGGATGG + Intronic
1007378018 6:41469533-41469555 CTGCAGTCACTCAGGGAGGAGGG + Intergenic
1009932531 6:70193401-70193423 GGGCAGGAACTCAGAGAGGAAGG - Intronic
1010209497 6:73351910-73351932 TTACAGGTTCTGAGGGAGGAGGG - Intergenic
1014174877 6:118321395-118321417 GTGTAAGTCCTCAGTTAGGAAGG + Intergenic
1015254649 6:131164400-131164422 GAGCAGGTGCTGAGAGAGGAAGG + Intronic
1016010898 6:139135974-139135996 GTGCCGGGCCGAAGGGAGGAAGG + Intronic
1018195094 6:161348500-161348522 GTGCAGGGCCTCTGAGACGACGG + Exonic
1018202821 6:161411064-161411086 GTGCAGGGCCTCTGGGATGCTGG + Intronic
1018977228 6:168574743-168574765 GTGCCGGTCTTCAGGGAGGTCGG - Intronic
1019138813 6:169930006-169930028 GTGGAGGTCAACAGTGAGGATGG + Intergenic
1019521470 7:1462385-1462407 GTGCAGGGGCTGCGGGAGGAAGG + Intergenic
1019594521 7:1852243-1852265 GGGCAGTTTCTCAGGGATGACGG + Intronic
1019609336 7:1929081-1929103 CTGCTCGGCCTCAGGGAGGAGGG - Intronic
1019630390 7:2045962-2045984 GGGCAGGCCCTCAGGGAGCAGGG - Intronic
1019722636 7:2582494-2582516 GTGCCGGTGCTCTGGCAGGAGGG + Intronic
1021239181 7:18179380-18179402 GCTGAGGTCCTAAGGGAGGAGGG + Intronic
1021263978 7:18496113-18496135 CTGCTTCTCCTCAGGGAGGAGGG + Intronic
1021318531 7:19182235-19182257 GTGCATGTCATCAGGGAGCCTGG + Intergenic
1021504828 7:21370384-21370406 GTGCAGGTCCTCAGGTGTGAGGG + Intergenic
1022040138 7:26573356-26573378 GAGGTGGTCCTCAGAGAGGAAGG + Intergenic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022959485 7:35412955-35412977 GTGTAGGTCCACAGGCAAGATGG - Intergenic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1028590223 7:92485226-92485248 GTGCAGGTCACAGGGGAGGATGG + Intergenic
1029170528 7:98626733-98626755 GTGCCGCTGCGCAGGGAGGACGG + Intronic
1030605340 7:111633649-111633671 GTGCAGCACACCAGGGAGGAGGG - Intergenic
1031675772 7:124610292-124610314 GTGCAGGTCACCAGGGAAGTGGG - Intergenic
1034273206 7:149813130-149813152 GTGGAGGTGCTGAGGGAGGTGGG + Intergenic
1034587506 7:152108104-152108126 GTGCCGGTCCTCACGGATGGCGG - Exonic
1034943710 7:155248622-155248644 GTGCCGGTGCTCCGTGAGGATGG + Intergenic
1034975339 7:155445737-155445759 GTCCAGCTCCACAGGGATGAAGG + Intergenic
1035319937 7:158022300-158022322 GTGGAGGCCGTCAGGAAGGATGG - Intronic
1035746898 8:1967484-1967506 GTGGGGGTGCCCAGGGAGGAGGG - Intergenic
1035760616 8:2066082-2066104 GACCAGTTCCTCAGTGAGGAAGG - Intronic
1036391727 8:8329794-8329816 CTGCTGCTCCACAGGGAGGAGGG + Intronic
1036963448 8:13270812-13270834 GTGAAGGCCCTCAGGAAGTAGGG + Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037829018 8:22177340-22177362 GTGGAGCTCCTCTGGGAGGCTGG + Intronic
1039095565 8:33880983-33881005 ATGCAGGTTCTCAGGGAAGTCGG + Intergenic
1040566588 8:48573056-48573078 GTGCAGGTCCTCTGCCATGAAGG + Intergenic
1040711548 8:50195199-50195221 ATGCAGGTCATCAGGGAAGTGGG + Intronic
1042339302 8:67662084-67662106 GTGCAGGTTCTGGGGGAGGCAGG + Intronic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1044818984 8:96143424-96143446 ATGGTGGGCCTCAGGGAGGATGG - Exonic
1044929914 8:97242059-97242081 GTGAAGGGGCACAGGGAGGAAGG - Intergenic
1045005789 8:97915527-97915549 GTGTAGGTACACAAGGAGGAAGG - Intronic
1047262561 8:123275112-123275134 GTGGCGGTTCGCAGGGAGGAGGG - Intronic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1047725002 8:127676621-127676643 GTGCAGGGCCTCATGGATCACGG - Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1048971183 8:139645736-139645758 GGGCAGGTGCTCAGGATGGATGG - Intronic
1049159098 8:141086127-141086149 GTGCAGGTCCCCACGAGGGAGGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049368795 8:142253673-142253695 TTGCAAGGCCTCAGGCAGGATGG + Intronic
1049446415 8:142633516-142633538 GTGCAGGTCCTCTGGGTGACAGG - Intergenic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702820 8:144022834-144022856 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049702992 8:144023447-144023469 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1052124287 9:24756100-24756122 ATGCAGTTCCCCAGAGAGGAGGG - Intergenic
1053298401 9:36931315-36931337 GTGAAGGTCCTCAGACAGGTGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057844911 9:98515720-98515742 CTCCAAGCCCTCAGGGAGGAAGG + Intronic
1059083111 9:111271183-111271205 CTGCATGTCCTCAGGGAGTCTGG + Intergenic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1060446351 9:123691802-123691824 GTGAAAGTCCTCAAGGAAGAAGG + Intronic
1061424321 9:130489637-130489659 GTGCAGGGCATGAGGGAGCAAGG + Intronic
1061714987 9:132513448-132513470 GGGAGGGTCCTCAGGGAAGACGG - Intronic
1186212501 X:7264284-7264306 GTGCAATTCCTAAGAGAGGAAGG + Intronic
1187307983 X:18114433-18114455 GTGCAGGTTCTGAGGCATGATGG - Intergenic
1188291602 X:28395774-28395796 ATGCAGGTCCTTAATGAGGATGG + Intergenic
1188716540 X:33465383-33465405 CTGCAGGTGCCCAGGGAGCATGG - Intergenic
1189218148 X:39344938-39344960 GTGCAGGTTGTCAGGGAAGTGGG - Intergenic
1192100880 X:68263216-68263238 GTGGAGGTTCGTAGGGAGGAAGG - Intronic
1192473435 X:71419430-71419452 GTGCATTTCCCCAGGGAGAAGGG + Intronic
1195156983 X:102133413-102133435 GTTCAGGTTCCAAGGGAGGAAGG + Intergenic
1199697635 X:150354317-150354339 TTCCTGGGCCTCAGGGAGGAGGG + Intergenic
1200078987 X:153566279-153566301 TGGCAGGACCTCAGGGAGGAGGG - Intronic
1200106832 X:153718876-153718898 GAGCAGATCCTCCTGGAGGATGG - Intronic
1201306681 Y:12556553-12556575 ATGCAGGTCATCAGGGAAGTGGG - Intergenic
1201315788 Y:12644101-12644123 ATGCAGGTTGTCAGGGAAGAGGG - Intergenic
1201519449 Y:14857226-14857248 TAGAAGGTCCTCTGGGAGGAAGG + Intergenic
1201585485 Y:15555892-15555914 GTGCAATTCCTGAGAGAGGAAGG + Intergenic